Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB21YI08FM1
Length(NT) : 643
Best Gene Model Blast : Link to GSTUMT00008099001 E-value : 6e-96
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 123 E_value: 9e-08
PFAM Definition: Extensin_2, Extensin-like region..
Pfam Number: pfam04554 Score: 115 E_value: 6e-07

Sequence:
>SY0AAB21YI08FM1
TTGGCCCTCTTGGAACGAAGGGACGAACGAACAAACTCTATCGTTCCCTC
CTATCGATTTTTTTCAGCAAAATAGTTCCGTGAAGGACACATTTTTATTG
CGCATAATACGCCCACAAACATGCCATCACCGCTGCAGGCCCTGCTCTTT
CTCCTCCTCCAATCGCTCACAACCCCCGCCTCCGCTTTCCCGAGGAGAGC
CCGACTCGACGTTAGCGGGGGATCGGGGGGTTCTGCTACCGGCCGAACCA
CAGTGTACTCCTCCCTGTATTCTCATCTTCTATTCTTCTCACTTACCGTC
CCGCAGAGAAATAAAGTCCCCAGGCATAATCGCAGGAATAGCTCTCGGGT
CGATCGCACTCGTAATAATCCTCCTGGCGGCATTCATCTGGCGGCGAAAG
GTCTGGCAGGATCGACAGGATCAGGAGGATTGGGAACGGGCGGGGAGGAG
CATGCTGGATGGTGCGGAGCCACTGGCGGCGGTGGGGAGGGATGGGTAGT
TGGAGGAGGAGCAGGGGCTTGTGGAGAAGGGAGCGGAGGGGAGGGGGACT
TAAGGGAACGCTTTGAGTAGATGGGCAGGGGGATGGAATGGGTTGTGTTG
CCATTTTCCCTTTTGCAATTATCCCTTATTTCACCATGTATCA

Sequences in the Contig:

SY0AAB21YI08FM1