Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB21YH02FM1
Length(NT) : 521
Best Gene Model Blast : Link to GSTUMT00002147001 E-value : 1e-142
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CaO19_1981
Accession: ref|XP_715743.1| Score: 166 E_value: 2e-10
KEGG Definition: CaO19.1981; hypothetical protein [EC:3.4.99.-]; K09648 mitochondrial inner membrane protease subunit 2
Accession: cal:CaO19_1981 Score: 166 E_value: 9e-11
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones, Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG1568 Score: 288 E_value: 4e-27
PFAM Definition: DUF1421, Protein of unknown function (DUF1421). This family represents a conserved region approximately 350 residues long within a number of plant proteins of unknown function..
Pfam Number: pfam07223 Score: 131 E_value: 6e-09
Swissprot: Q9UST2|IMP2L_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>SY0AAB21YH02FM1
TTGGCGAAAAAGAAAAGAAAAAACGGATATCAACAACAACCAACATGCCC
CTCCCCCTCCTCCTCCCCACCTTGAAAACCCTCCCGCTAACCCTGCCAAT
CCTAATCTTCATAACAAACCACGTCTACTCCCTCCACCGGATCCACGGAA
GAAGCATGTCGCCAACCCTCCCCCGCGACATGATAATCCTGGCGCAGCGA
CACAACGCTACGGCGGGTCTGCGGCGCGGTCAGGTGGTCCTGTACCGCTC
GCCGGTGGATCCGGAGAGGGTCGCTGTGAAGAGGGTTGTCGGGCTTGAGG
GGGATGTGGTCGTTGTCAGGCCGGTGGGTGGCGGGTTGGCGGGCGGGAGG
GTTGGGGAGGCGGTCAGGGTCGGTGCGGGGAAAGTGTGGGTGGAGGGGGA
TGAGGGGTTTTGGTCGGTTGATAGCAATGTTTATGGGGCTATTCCGAAAG
CTCTGATCGAGGCAAAGGTTACTCACGTGGTCTGGCCGCCGTCAAGGGCC
GGGAGGGTCAAGGAAGATCAT

Sequences in the Contig:

SY0AAB21YH02FM1