Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB21YC09FM1
Length(NT) : 691
Best Gene Model Blast : Link to GSTUMT00004861001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001215019.1| Score: 385 E_value: 1e-35
KEGG Definition: hypothetical protein
Accession: ang:An11g01950 Score: 380 E_value: 3e-35
KOG Definition:
Classification: [Transcription].
Kog Number: KOG1926 Score: 239 E_value: 3e-21
PFAM Definition: DNA_pol_phi, DNA polymerase phi. This family includes the fifth essential DNA polymerase in yeast EC:2.7.7.7. Pol5p is localised exclusively to the nucleolus and binds near or at the enhancer region of rRNA-encoding DNA repeating units..
Pfam Number: pfam04931 Score: 301 E_value: 2e-28
Swissprot: O60094|DPO5_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005730 = Cellular component: nucleolus
GO:0005515 = Molecular function: protein binding
GO:0000182 = Molecular function: rDNA binding
GO:0042790 = Biological process: transcription of nuclear rRNA large RNA polymerase I transcript

Sequence:
>SY0AAB21YC09FM1
TTGGCGGGGCCGAACTGGGAATACCAGTATCACCCACCAGCCAGTTAATG
TTCAGATCCAGACTCATGTCCTGCCTATCCCACCTACTCAGCATCAAGGA
TGACATCTCCGGCAACGAGACATGGCCGTACCGTGCCGTCAAGAAAGTCC
TCAATAACAAAGAGACACTAACAATCGAGCTCGACGACACCATCGAAACA
GCTATAAAGAGCGCCCAATCAACGCTCAAGAAAATAAACAAAAAGCGCAC
CTCAGCCCGAAAATCCGACAAGACCAAGAGAGCCACCCAACTGGAGTCTT
TCGAACTCCTCTACTCCCTCGTCATCCTACAAATCCTGAGCGGTGAACCA
GACGCGCTGGAGGTTCTTGACGAGCTAAGCCTTTGCTACGAGAGGGTTAT
CAAGAAGCGGAAACATGCGACGGAGGATGAAGTCGAAGTTAGTGAAGTTT
TGATGGAGATCTTGCTAAGCTTCTTGTCGAAGCCGAGCGTCCTACTGCGG
AAATTGGCACAGCAAGTGTTCACGGCATTTGTGGATAGTGTTACCGATGC
TGGCTTGGAACTATTGACGAATGTACTGGAGACGAAGGAGAGTCTGAGTG
GGCAGCAGGAGCTCTTCGGTGGAGTCGATGAAGATGAAGACGGCGAAGTC
ATGGACGATGGAACCGACGACGCCGAGGAAGTAAATTTCTC

Sequences in the Contig:

SY0AAB21YC09FM1