Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB20YN12FM1
Length(NT) : 643
Best Gene Model Blast : Link to GSTUMT00006246001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_07794
Accession: ref|XP_001591169.1| Score: 925 E_value: 3e-98
KEGG Definition: hypothetical protein
Accession: ang:An14g04190 Score: 918 E_value: 9e-98
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG0470 Score: 709 E_value: 1e-75
PFAM Definition: No Hit Found
Swissprot: Q9Y8H3|GLGB_EMENI
Gene Ontology:
GO:0003844 = Molecular function: 1,4-alpha-glucan branching enzyme activity

Sequence:
>SY0AAB20YN12FM1
TTGGGGGGTTGTCGGCTTCGACTACCGTCTTGCGATGGCCATCCCAGATA
TGTGGATTAAGTTGTTGAAAGAAAAAAAAGACGATGAATGGGATATGTCC
AATATCTGCTGGATTTTGACCAATAGACGACACGGGGAGAAGACTATTGC
TTATGCGGAGAGTCACGACCAAGCGTTGGTTGGAGACAAATCGATTCTCA
TGTGGCTCTGTGACAAGGAGCTCTATACTAACATGTCGACACTCACCGAC
TTTACCCCTATCATTGAGCGCGGTCTTGCCCTCCACAAGATGATAAGACT
CCTAACTCACGGATTGGGCGGTGAGGGCTATCTCAACTTTGAGGGAAATG
AATTCGGCCACCCCGAATGGCTGGATTTCCCTCGTGCCGGTAACAACAAC
TCTTTCCACTACGCTAGACGGCAATGGAATATCCTCGATGACCCCCTCCT
GAGATACAAATTTCTCAACGACTTTGATGCTTCCATGCAACATCTTGAAC
AACGCTACGGATGGCTGCATGCGCCCCAAGCCTACATTAGCTTGAAGCAC
GAGGGTGATAAGATCATCGTATTTGAGCGCGCAGGATTGGTTTTTGTATT
CAACTTCCATCCTACAGAGAGCTTTGCGGATTTCCGGATCGGA

Sequences in the Contig:

SY0AAB20YN12FM1