Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB20YM23FM1
Length(NT) : 649
Best Gene Model Blast : Link to GSTUMT00002563001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_06554
Accession: ref|XP_001222649.1| Score: 263 E_value: 2e-21
KEGG Definition: hypothetical protein
Accession: ncr:NCU01994.1 Score: 257 E_value: 4e-21
KOG Definition: No Hit Found
PFAM Definition: bZIP_1, bZIP transcription factor. The Pfam entry includes the basic region and the leucine zipper region..
Pfam Number: pfam00170 Score: 127 E_value: 3e-08
Swissprot: Q01663|AP1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0003700 = Molecular function: transcription factor activity
GO:0006355 = Biological process: regulation of transcription, DNA-dependent
GO:0046685 = Biological process: response to arsenic
GO:0031000 = Biological process: response to caffeine
GO:0042542 = Biological process: response to hydrogen peroxide
GO:0051595 = Biological process: response to methylglyoxal

Sequence:
>SY0AAB20YM23FM1
TTGGCAGCCAACCTTCTTTACACAACCCCAAGCAATCTACCAACCTACCC
CTACATCCTCGCACCAGGCCGATGAGTTTTCATCTCTGTCGTTCCCAAAC
TACCCTACATTCGACTTTTTTGAACAGCAAAGCCATCACAACATTACGCC
ATCGTTAAGAGGTCATACTCCTATTGACCCAGAAACACACAGGAATGGGA
GGAGCAGCAGTGAAGAAAAGGAGTTGACACCGGGACAGCGGGTAAGCCAG
ACCGCTGATGACTCCAATGCTTCAATGGATGGTACCCTGACAGCAACACA
GAGACGGAAAGAACAGAATCGAGCAGCGCAACGTGCATTTCGGGAGCGTA
AGGAACGACATGTTAAGGAGCTGGAACACAGACTCAAGACGTTGGAGCAG
CACGCATCAGAAACAGCGTCACAAAACGAGATACTGAAGCAAGAGCTCCA
AAAGACCAAACTTGAAAACAGACTTCTGCAAGAGAACAGTCTGCGAGGCA
ACTCACCGCCGGCAATGACCGAAGTGGCAAACATGAACTTCAAGCCGACG
GACCACCACAACATCGCCAATCCCCCTCCAGCCTTCACGTCTCCGATATT
CGGGGAACACCCAAACAGAGGCCCGCTGCACAGGATTTCGACGAGCCCG

Sequences in the Contig:

SY0AAB20YM23FM1