Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB20YM02FM1
Length(NT) : 579
Best Gene Model Blast : Link to GSTUMT00011086001 E-value : 1e-81
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_10335
Accession: ref|XP_001588788.1| Score: 204 E_value: 9e-15
KEGG Definition: predicted protein
Accession: mgr:MGG_04105 Score: 201 E_value: 1e-14
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1773 Score: 197 E_value: 2e-16
PFAM Definition: UPF0057, Uncharacterized protein family UPF0057..
Pfam Number: pfam01679 Score: 173 E_value: 1e-13
Swissprot: Q871V2|PMP3_NEUCR
Gene Ontology:
GO:0005886 = Cellular component: plasma membrane

Sequence:
>SY0AAB20YM02FM1
TTGGGTGATACCCAGTACAGCTTTGCTCCTTGAACAAACTTGACATTTTA
TCGAAACCAGCATCGAACCGCTTAAGCTTACAAACTACTGCTACGACCAA
CCAACCAACCACAACCACAATCACAACCACAACCACAACAAACACCATCA
TGCCTTTCACCGCCAGTGATGTTTGCAAGATCCTTCTCGCTATCCTTCTT
CCTCCTCTTGGTGTCTTTCTGGAGAGGGGATGCAGCGGTGATCTATTGAT
CAATATTATTTTCACCTGCTTGGGTTACTTGCCTGGCATCATTCACGCCC
TGTGAGCTTCTCTCTCTCCTTTCGAGTCCTTTTTGGAGCGTCGCGGTTGC
TAATTCCTACCCACCAGATACATTATATTTAGGTACTAGAGAGACGCGAA
ACCCCCACGATCCTTATTTCCTCGAGCACAAACAACGTCGGTCAGTGGAA
AAGATATGGTAATTCTTGAATTGATACCGTCTGGGAGGGCGGTCATTGTC
TGCCGGTCGGTCTTTACATGAGGAGTGTTTCGGGCCAAAAATGTCGGGCT
CTCTCCTTCTCTCTCTCTTTTGTAGTTGC

Sequences in the Contig:

SY0AAB20YM02FM1