Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB20YL12FM1
Length(NT) : 579
Best Gene Model Blast : Link to GSTUMT00000250001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_01760
Accession: ref|XP_001247989.1| Score: 321 E_value: 2e-28
KEGG Definition: hypothetical protein
Accession: ani:AN3734.2 Score: 297 E_value: 8e-26
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2173 Score: 241 E_value: 1e-21
PFAM Definition: APG9, Autophagy protein Apg9. In yeast, 15 Apg proteins coordinate the formation of autophagosomes. Autophagy is a bulk degradation process induced by starvation in eukaryotic cells. Apg9 plays a direct role in the formation of the cytoplasm to vacuole targeting and autophagic vesicles, possibly serving as a marker for a specialised compartment essential for these vesicle-mediated alternative targeting pathways..
Pfam Number: pfam04109 Score: 204 E_value: 2e-17
Swissprot: Q1E6Q3|ATG9_COCIM
Gene Ontology:
GO:0034045 = Cellular component: pre-autophagosomal structure membrane

Sequence:
>SY0AAB20YL12FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCAAGAAAGAGTTTATGTCT
CTGTACGACCTCAAGGTGACGATATTCCTTGGGGAAGTCATGAGTGTCAT
ATTCACACCGTTTGTTCTTTGGGTCTCACTTTCGAACCGTTCAGAAAGGA
TTATCGATTTCTTCCGGGAGTTTACTGTTCACGTTGACGGCATTGGATAT
GTCTGCAGTTTTGCAGTATTTGATTTCCAAAAACCCGGTGACAACAAAAT
GCTCTCCTCATATCTTGGTTTCATGGATCAGTACCACGGCCCGCAGAACA
AAGGAGGGGCAAACAAACGCCAGATGTCAATGCGTAATTATATGTCCCCC
ATGCTAAACGCCCAGACTGGCAAAGGAAAGGATGGCCGCGGTGCCCAAGA
CCGCCGTGCAGGTGATGGACGCCAGGATATGCAACAATCAATCCACCGAG
ACAACCCTGGAAGAATGCAGGGCTCTCAGATACTCCAATCCTCCCTCTTA
GACCAACACCACCAGCCACCACCTTTTGTAGCGAGAGCCCCGAGGCACCC
TTCATTCCACCTATCCACAGCAGAATCGC

Sequences in the Contig:

SY0AAB20YL12FM1