Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB20YK19FM1
Length(NT) : 612
Best Gene Model Blast : Link to GSTUMT00002251001 E-value : 1e-38
Numbers of ESTs : 1

Blast Results:

Nr Definition: NUDIX family hydrolase, putative
Accession: gb|EDP56060.1| Score: 137 E_value: 6e-07
KEGG Definition: NUDIX family hydrolase, putative
Accession: afm:AFUA_1G07260 Score: 137 E_value: 3e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB20YK19FM1
TTGGCCTACATTTACAAGTTGGGATGTTAGAGGCGTTGTGTGGTTGATGA
CCCGAGAACTTAGAAAGAGGAATTGGGAGGCTGTGAGTAGGGGCAGCCTG
GGAAAAGCATTTTGCGAGAGCGAAGACACAGAGAGCAGTCTCGTCCTCGT
CAAGGAAAATGACAATGGCACTGCCAGCGCCTCGAGAGGCGAAACCACCA
GCGCCGTGAAGATTCTCTTGGAGGGGTACTATGACGTCGTGCGAAAGGCT
GTCTGGATCACTCTTTGCGGAAGGGCTGTAATCGCATCGACCGCTTTGGG
AGCTGTAGCATGGAGGTATTGGTATACGCGACGTTAGTGTATCATTCATA
GCCTGCCTCGCCTTCCGGTGACGTTTCAGGTTCCTTGCACTCAGACGCAG
AGACAACAAGGGGGAGCCGTGTGAACTGGGGGTGGTTCTTTGAGTCTGGG
GTACGGCACGGCACCAGCACCAGCAAACCGAGCTCTCTTTTTGTAACGCA
TAGCGATCCGGGGAATGGAATTATGGCATTTCTTTTTCTTCCTTCGTTAT
TTAGTTCTTGGTTGGTTGGTTGGTTGGTTGTTGGTTGGTTGGTTTGGGAT
GAAATTGGTTGC

Sequences in the Contig:

SY0AAB20YK19FM1