Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB20YJ23FM1
Length(NT) : 559
Best Gene Model Blast : Link to GSTUMT00000266001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An07g05830
Accession: ref|XP_001391662.1| Score: 780 E_value: 1e-81
KEGG Definition: hypothetical protein
Accession: ang:An07g05830 Score: 780 E_value: 7e-82
KOG Definition: No Hit Found
PFAM Definition: FmdA_AmdA, Acetamidase/Formamidase family. This family includes amidohydrolases of formamide EC:3.5.1.49 and acetamide. Methylophilus methylotrophus formamidase forms a homotrimer suggesting all the members of this family also do..
Pfam Number: pfam03069 Score: 514 E_value: 3e-53
Swissprot: Q9URY7|FMDA_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAB20YJ23FM1
TTGGAAACCTACCTCCCTGTGCACGTTCCCGGTGCAAAGTTCTCTGTGGG
GGACTTACACTTCTCGCAAGGTGATGGAGAGATTAGTTTCTGCGGGGCTA
TCGAAATGGCTGGAATCATCACTCTTAAGTTTGAGCTTATGAAGGGGGGC
ATTCGAGAACTTGACATGAAGAGCCCGATCTTCATCCCTGGCCCTGTGGA
GCCACATTTCGGTCCCGGCCGAATGCTCACTTTTGAGGGGTTCTCCGTGG
ATGAGGCTGGAAAACAGCATTACATGGATGTCACAGTTGCTTACAGGCAG
ACTTGCCTCAGGGTAATTGAGTATTTGAAGAGGTTTGGATACTCGGGCGA
ACAGATTTATCTGTTGCTGTCTTGTGCCCCGGTTCAGGGACATGTTGCTG
GAATTGTTGACATTCCAAACGCCTGCACAACCATGAGTGTCCCAATGGAC
ATCTTTGACTTTGATATATCCCCCGGTGCACCGATCCCGAGGTTGGATAT
GGGCTCTTGCGCGTACACTTCTGATAGGAGGTAAATTATACGAAGCGAAA
ATGTGGTTC

Sequences in the Contig:

SY0AAB20YJ23FM1