Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB20YJ21FM1
Length(NT) : 649
Best Gene Model Blast : Link to GSTUMT00000201001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE59253.1| Score: 173 E_value: 5e-11
KEGG Definition: predicted protein
Accession: aor:AO090023000748 Score: 173 E_value: 2e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB20YJ21FM1
TTGGAGGCAAGGCAAACGTTATGGACCTGAAGCACATATCCCCGGAAACC
ATGCACCGGTTCATGGAATTCTGCTACTCTGGAGACTACTTATTCCCCCC
CGGTGCCGAACGAAAAGACCCACTAAAGTACAAAGAGGCTACTGAAGCCC
TCCCGATCCTACTAACGCATGCAAGGCTATACGTCTTTGCCGAGATGTTC
AACATTGTCTCACTGAAAAGGCTGTCCGCGGACAAGATCATCGCAATCAC
ACCCCTCTTCGGGAGGTTGGAGGAAAGGGCGCATGGGCTTGCAGTGATTT
CCCTGATGGAATTTGTGCTGGATAATATACCCGCCACTACTGAAACGACA
GATAGACTGGTGAAGTTCTTGGCGAGGTATTCCGGGTATTTTGTCGAGCA
GATCGGGGGGTATCCGGAGTTCCATGCGCTTCTAGCGAGTTCCGCGCGAG
AGGACTTTTTTAGGGTGTTTTGTAAGTGGGTGAGGGCGGGGGGGGATAGA
GAGCCGTGGACTGATATAGAATGAGGTTTTGGTGGTGATGGGGTTTCTTG
CTCGGTGATCTGGATGGCTTTTCTGGACTATTTCTCTCTCAGCCAGAGTG
TTTTTCTTTTTCTTTATGACAGCAAGTTAGGTAGCAATTTTTGCAAAGA

Sequences in the Contig:

SY0AAB20YJ21FM1