Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB20YJ09FM1
Length(NT) : 672
Best Gene Model Blast : Link to GSTUMT00004838001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU07735
Accession: ref|XP_961985.1| Score: 351 E_value: 1e-31
KEGG Definition: hypothetical protein
Accession: ncr:NCU07735.1 Score: 351 E_value: 6e-32
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0108 Score: 139 E_value: 1e-09
PFAM Definition: RRM_1, RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain). The RRM motif is probably diagnostic of an RNA binding protein. RRMs are found in a variety of RNA binding proteins, including various hnRNP proteins, proteins implicated in regulation of alternative splicing, and protein components of snRNPs. The motif also appears in a few single stranded DNA binding proteins. The RRM structure consists of four strands and two helices arranged in an alpha/beta sandwich, with a third helix present during RNA binding in some cases The C-terminal beta strand (4th strand) and final helix are hard to align and have been omitted in the SEED alignment The LA proteins have a N terminus rrm which is included in the seed. There is a second region towards the C terminus that has some features of a rrm but does not appear to have the important structural core of a rrm. The LA proteins are one of the main autoantigens in Systemic lupus erythematosus (SLE), an autoimmune disease..
Pfam Number: pfam00076 Score: 178 E_value: 4e-14
Swissprot: P19684|ROC5_NICSY

Sequence:
>SY0AAB20YJ09FM1
TCAAACCAGCCCCAAGCCCTCCAGCCAGCAATCAAACCCCTTCGACAGTC
AAACGCAAAGCTTCGTTTCTCGGGCAGAACTCCTCTTTTTTCAAGGACAC
AGCACCATCTTTTTCTTTTTACCAAACGAGGCTTTTTGCTTTCCTCCATC
TAATCGTCAGGCAAAATTCAAACCGTCAAGCACCCACAAAAGAAAAACAT
GTCCACCAACGCCACTGAGACCGTCGCTGCTGCTGCTCCTGATACTGTTG
AGACTGTTACCGATGCTCTCAATGATGCTACTCTTGCTCCTATGACCGAA
ATTAGCGAGGCAGATGCTGCTCATGCTGCTTCTGCTGCTGAAGGCAGGAG
ACTTTACATCGGGAACCTTGCCTACGCTACTACTGAGGCGCAGCTAAAAG
AATTTTTCGAAGGGTTTTCTATTGAATCCATTTCCATCCCCACTAACCCT
CGTACCTCTCGTGCTGTTGGCTATGCCTTCGTTGATGTCACCACTAAGGA
AGAGGCAGAACGTGCAATTGCGGAGCTCAGTGGAAAAGAGGTTTTGGAGC
GCAAAGTTAGTGTCCAACTAGCCAGAAAGCCTGGCACATGAGGCTCCCCT
CTACTCGGATACTCCTGATACTTCTAAAAATGCTATAGCCAGTGTTCCCA
CTAGCCCAGCTGCCGAGGGTGA

Sequences in the Contig:

SY0AAB20YJ09FM1