Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB20YH01FM1
Length(NT) : 642
Best Gene Model Blast : Link to GSTUMT00003993001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_10778
Accession: ref|XP_001550234.1| Score: 342 E_value: 1e-30
KEGG Definition: hypothetical protein
Accession: ang:An08g10260 Score: 339 E_value: 1e-30
KOG Definition: No Hit Found
PFAM Definition: RTA1, RTA1 like protein. This family is comprised of fungal proteins with multiple transmembrane regions. RTA1 is involved in resistance to 7-aminocholesterol, while RTM1 confers resistance to an an unknown toxic chemical in molasses. These proteins may bind to the toxic substance, and thus prevent toxicity. They are not thought to be involved in the efflux of xenobiotics..
Pfam Number: pfam04479 Score: 200 E_value: 1e-16
Swissprot: Q08417|RSB1_YEAST
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum
GO:0016021 = Cellular component: integral to membrane
GO:0005886 = Cellular component: plasma membrane
GO:0004012 = Molecular function: phospholipid-translocating ATPase activity
GO:0015908 = Biological process: fatty acid transport
GO:0045332 = Biological process: phospholipid translocation
GO:0009636 = Biological process: response to toxin

Sequence:
>SY0AAB20YH01FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGACGAAAAGCAGGCATACC
GGCAGTCTGAAAACGAATTCGAGGATTATATAGCCTGCCATCCCCAAGCC
AGCGGAAAGAGAGAAGGAAAAAAGTCAATCATCCAAGCGCAGCATTATCA
CCAGCACTTTTACAAAAAAAAAAAACCCCCTTCGAGTCAAATTTCGTCCA
ACGACACTTTCGACAATGTCCGAAAAATTGATTGAGGGTCACAACATGAC
CTACTGGAACAGTATCGATTGCGATCTCGATATATGCCCTCTCAAGGCCT
CGTTTTGGGATTACCGGCCCTCTCTTGCCCTCAACTATCTCCTGATTGCA
CTCTTTGGTCTGTCTATGCTTGCGCACATTGGGCAAGGAATCAAGTACAA
GACATGGGGTTTCCTAGCGTCGATGTTCCTTGGGTGCTTTACTGAAATCA
TTGGATATGCTGGGCGGATATGGGCTTACCATGAACCCTTCTCAATGGAT
CCTTTCCTTATGCAAATCTGCAGCTTGACCCTTGCTCCGGCCTTCCTGTG
CGCAGGAATCTATCTCTGCCTCTCCAGAATTGTGATGGTCTTCGGTGCCG
AAACCTCCCGCATACCTCCAAAAGCTTACACATACATCTTCG

Sequences in the Contig:

SY0AAB20YH01FM1