Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB20YE13FM1
Length(NT) : 655
Best Gene Model Blast : Link to GSTUMT00007911001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_06991
Accession: ref|XP_001554403.1| Score: 498 E_value: 1e-48
KEGG Definition: hypothetical protein
Accession: ang:An03g03270 Score: 460 E_value: 1e-44
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0508 Score: 294 E_value: 1e-27
PFAM Definition: No Hit Found
Swissprot: P16157|ANK1_HUMAN
Gene Ontology:
GO:0016323 = Cellular component: basolateral plasma membrane
GO:0005856 = Cellular component: cytoskeleton
GO:0008093 = Molecular function: cytoskeletal adaptor activity
GO:0019899 = Molecular function: enzyme binding
GO:0030507 = Molecular function: spectrin binding
GO:0005200 = Molecular function: structural constituent of cytoskeleton
GO:0007010 = Biological process: cytoskeleton organization and biogenesis
GO:0006887 = Biological process: exocytosis
GO:0045199 = Biological process: maintenance of epithelial cell polarity

Sequence:
>SY0AAB20YE13FM1
TTGGATCCTGACCATCCAGACTCTGAACATGGCCAGACGCCACTCTCTTT
GGCCGCTGAGAATGGGCATGAGGGAATAGTAAAGATGCTTTTGGAACGAG
ATGTCAATCCCGACCAGCCAGGCACCAAAGATGGCCGGACGCCACTCTCT
TTGGCCGCTGAGAATGGGCATGAGGGAATAGTAAAGATGCTTTTCGAACG
AGATGTTAATCCCGACCAACCAGGCACCAAAGATGGCCGGACGCCACTCT
CTTGGGCCGCTGAGAATGGGCATCAGTGGATAGTGAAGATTCTTTTGGAA
CGAGATGTCAATCCTGACCATCCAGACTCTGAACATGGCCAGACGCCACT
CTCTTTGGCCGCTGAGAATGGGCATGAGGGAATAGTAAAGATGCTTTTGG
AACGAGATGTCAATCCCGACCAGCCGGGCACCAAAGATGGCCGGACGCCA
CTCTCTTTGGCCGCTGAGAACGGGCATGAGTCGATAGTAAAGATGCTTTT
CGAACGAGATGTCAATCCCGACCAGCCAGACACCTTTTATGGCCGGACGC
CACTCTTGTGGGCCGCTAAGAACAGGCATGAGGCGGTAGTTGAGACGCTT
TTGGAGCGAGGCGATGTCAATCCCGACCGGCCGGACAACGTGTATGGCCT
GACAC

Sequences in the Contig:

SY0AAB20YE13FM1