Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB20YD19FM1
Length(NT) : 615
Best Gene Model Blast : Link to GSTUMT00012124001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001540925.1| Score: 341 E_value: 1e-30
KEGG Definition: hypothetical protein
Accession: ang:An01g05180 Score: 338 E_value: 2e-30
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1310 Score: 140 E_value: 8e-10
PFAM Definition: No Hit Found
Swissprot: O94527|YBU3_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>SY0AAB20YD19FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTGAGTTGAGTAGTGGCGGG
GCACCCCCGTTGATCAGTTACCGCAAGTGGGGGGTTGAGTTGAATGCCAT
TTCTTGCTCGACGAGCCAACCGTTCTATATCGCGCTGGGCGGTCGGAATT
TGCATTGCTTCTTGCACGATAGGAGGATGTCTGGGAGGGATTTGGCGGCT
GAAAGTGGCGCCGGGAGGAGTTTGAGTCCTAGCTCTAGCTCTAGCTCTAG
CACCACCACCACTGCTATGGACACGGCGACTAGGTGTGTTAGGAAGTTTG
TGCCCAGGCCTGATGGCAGTGGGGGATGGCCGGATCCGCATATTACGTCT
TGTAAGATCTCTGATGCGCATCCAGATAACGTGCTCGTCTCTTGGAGCGG
GGATGGGATATACATGTTTAGCATCAACCAGAGTCCCGAAGAACCCAGCA
GTGGCAGCGATGGGAAGGGGAAGGAAGCCTGGAATCCGGACGAGCGCAGA
GACCGAGACGAATCTGATCCCGGGCCTAGTGGTAGCAGCAGTAGTCGCGG
TAGAAGACGCAGCGCCGACGAACCAATGTCCAAGAGACTTCGAGAGTCAG
GCCGCGGCTCTTCTT

Sequences in the Contig:

SY0AAB20YD19FM1