Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB20YA01FM1
Length(NT) : 592
Best Gene Model Blast : Link to GSTUMT00008819001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An01g05090
Accession: ref|XP_001388935.1| Score: 708 E_value: 3e-73
KEGG Definition: hypothetical protein
Accession: ang:An01g05090 Score: 708 E_value: 2e-73
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG2058 Score: 384 E_value: 4e-38
PFAM Definition: TBC, TBC domain. Identification of a TBC domain in GYP6_YEAST and GYP7_YEAST, which are GTPase activator proteins of yeast Ypt6 and Ypt7, imply that these domains are GTPase activator proteins of Rab-like small GTPases..
Pfam Number: pfam00566 Score: 435 E_value: 4e-44
Swissprot: P36618|CDC16_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0005096 = Molecular function: GTPase activator activity
GO:0005515 = Molecular function: protein binding
GO:0007094 = Biological process: mitotic cell cycle spindle assembly checkpoint
GO:0031030 = Biological process: negative regulation of septation initiation signaling

Sequence:
>SY0AAB20YA01FM1
TTGGATTCAGAACACTTGCCACTGACCCCCTATTTCGTCGAAGGGTCTCT
GAGGCTTCGCTGATCCGGCTTTTGAATGCATTTCAATGGAAAATGCGAGA
TTCTGGTACCGACGCTCAATACGTTCAGGGCATGAACGTCATTGCCGCCC
CTTTTCTCTACGCCGCGAGGAGCGAAGTGGAGGCCTTTTCCCTTTTTTCG
GTGTTTATTCAGAGAGAGTGTCCGGGCTATGTTAAACCGACAATGGAGGG
TGTCCACCGCGGACTCAAATTGGTGGATCAATGCTTAGAAACGGTGGATC
CGAAATTATATGCTCACTTACAATCAAAGTTTCTCTCTGCAGAATTATAT
GCCTTCCCTTCCGTCTTAACACTGTCAGCATGTACACCTCCGCTTCCCGA
GGTGCTAAAGTTATGGGATTTCCTCTTGGCGTATGGGGCCCATCTCAACA
TCTTATGTGTAGTCGGGCAGCTGCTGTTGATGCGGGATGAGTTGCTGGTC
GCCCAAAGCCCAATGAAACTTCTACGCCAATTTCCGCCGTTGAACGCAAA
AATGATTGTCAGTGTTGCTGTGAGCTTAGTGCGAAAGATCCC

Sequences in the Contig:

SY0AAB20YA01FM1