Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB1YP01FM1
Length(NT) : 619
Best Gene Model Blast : Link to GSTUMT00005320001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: regulatory factor Sgt1, putative
Accession: ref|XP_001270949.1| Score: 438 E_value: 8e-42
KEGG Definition: regulatory factor Sgt1, putative
Accession: afm:AFUA_3G09380 Score: 432 E_value: 2e-41
KOG Definition:
Classification: [Transcription].
Kog Number: KOG2406 Score: 277 E_value: 1e-25
PFAM Definition: SGT1, SGT1 protein. This family consists of several eukaryotic SGT1 proteins. Human SGT1 or hSGT1 is known to suppress GCR2 and is highly expressed in the muscle and heart. The function of this family is unknown although it has been speculated that SGT1 may be functionally analogous to the Gcr2p protein of Saccharomyces cerevisiae which is known to be a regulatory factor of glycolytic gene expression..
Pfam Number: pfam07093 Score: 232 E_value: 2e-20
Swissprot: O95905|SGT1_HUMAN
Gene Ontology:
GO:0003713 = Molecular function: transcription coactivator activity
GO:0006110 = Biological process: regulation of glycolysis
GO:0006366 = Biological process: transcription from RNA polymerase II promoter

Sequence:
>SY0AAB1YP01FM1
TTGGCAATCCTCACCTCCGACTCGTGCGCCCTTCTCCAGCGGATTCGTCT
GGTAGAAGAAGAGGCTTTCTATAGGCTCGAAAGATATCCGAAGGCAATAC
AAGAACAACTACATTATACAGAGGCCCTCATCCCACGAACTTGCGCGATG
GTCTTGCATGAGGCACCGGAATCGATAGCTGCGGCCGTAGAAGCCTTCTA
CCTGCGCGACCCGATATCTCTTAAGTCACTGAAATCGATGAGCCACTTCC
CACCTAGCGATATGGTCACGACCTCAGTTAGGTTTACCAAAGTTCTCTAC
GCCCAACTCAAATCGCAGGAGTTCGAACCACCATCTGGGAGTGGGTTTGA
GGTCTCACCTGATATGCCAACTGTGAATATGATCGGGATCAAGCTTGCTT
GCGGTTTTGAAATGCTCATTAGTGACAACGCTGCTCCACAAGTTTCGTCC
AAGGCGAGGAAAAATATAGTCAGACGGGTTAAAGATATACTACAAACGAA
AACACCACCGACGGACGAGGAAATTTCATCATGGCCTCAACGGATCGATG
GTGAGGATTGGTTGGATATCAACTATGAAGATTTAGAAAGGGATCTTTCA
GGACGCAATGCCGACCCAT

Sequences in the Contig:

SY0AAB1YP01FM1