Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB1YN24FM1
Length(NT) : 459
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG11425.1
Accession: ref|XP_391601.1| Score: 246 E_value: 7e-20
KEGG Definition: hypothetical protein
Accession: fgr:FG11425.1 Score: 246 E_value: 3e-20
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB1YN24FM1
TTGGGTTGGGAGCTGCGTACGGTGCAGCGATAGAACGGATAAGGACACAG
GGTGGAGATAGGTCGAGATTCGGGATGGCGGCATTGATGTGGGTGGGTCA
TGCCGAACGGCCCTTGGGGGCAGATGAGCTCTGCAATGCCCTAGCGGTCC
AGTTAGGTTCAACGGATTTCAATGCAGGCAACATCCCTTCGATATCGACG
TTGGTAACCTGCTGTCAAGGGCTTATTACCGTAGACAAGGAGGGATCGAT
TGTGAGACTTATGCACTTTACTCTACACGAATACCTTTCCGCCCATCCTG
ATATTTTCAATGGCCCTCACTCGGCAATGGCGGAGATCTGTTTGAGTTAT
CTGAATTCCCGACATGTCAAAACCCTTTCGACCGTTCCCTCCCCTGACAC
CCAGGAAATACCCTTTCTAGAATATTGCTCCGTATACTGGGGAGTCCACG
CGAAAAGGG

Sequences in the Contig:

SY0AAB1YN24FM1