Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB1YN15FM1
Length(NT) : 562
Best Gene Model Blast : Link to GSTUMT00006938001 E-value : 1e-71
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_12295
Accession: ref|XP_001802519.1| Score: 284 E_value: 4e-24
KEGG Definition: conserved hypothetical protein
Accession: fgr:FG09498.1 Score: 278 E_value: 1e-23
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG3385 Score: 128 E_value: 2e-08
PFAM Definition: No Hit Found
Swissprot: Q09730|SFT1_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum
GO:0005794 = Cellular component: Golgi apparatus
GO:0006886 = Biological process: intracellular protein transport

Sequence:
>SY0AAB1YN15FM1
TTGGACAACCACCACCACAACCACAACCACAACCACAACCACTACACTAC
CGCTGCCACTACCACCACCCGCAGCCGAGCTGTCGAGAAAGAAAACGAAA
AAAAAAAGCAGAAACAGAGTTGTAATATGTCAGAAGCCTACGAGCGAGAA
CGGCAAAACAACGCTCGCCTCGATGACCTCGCTTCGAAGGTGACCTCTCT
CCGGGACGTCACGATAAATATATACGATAGTGCTAGGGATCATGAGATTA
TTGATAACTCGAATGAAGTCTTTGCAAACTTCACGACGGGGTTAAAGCAG
AGTGCCGGTCGTATCACGCGCATGGCAGCCACCGGGAGTAGAGGGCAGAC
GATAAAACTTGCTAGTATGATTGTGGGTGGGGTTATTGTTCTGTATTTAC
TTTGGGGAATGCTCTTTTGAATGGGGTCATTTACAAGAGTTTGGTGGCGA
TAATGGTGATGATGGCGATAGTGGAGGGAAAGTTCCCTCCTGTTTGATTG
TTTGACGGGATTGGTTTACACCTACAGGCGTTCTGGTCGTTTGTAAAGTA
TGATACTGTACG

Sequences in the Contig:

SY0AAB1YN15FM1