Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB1YL09FM1
Length(NT) : 667
Best Gene Model Blast : Link to GSTUMT00005851001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: G-protein alpha subunit
Accession: gb|ABE72963.1| Score: 912 E_value: 1e-96
KEGG Definition: G protein complex alpha subunit GpaB; K04640 guanine nucleotide binding protein (G protein), alpha, other
Accession: afm:AFUA_1G12930 Score: 896 E_value: 4e-95
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning, Signal transduction mechanisms].
Kog Number: KOG0082 Score: 742 E_value: 2e-79
PFAM Definition: G-alpha, G-protein alpha subunit. G proteins couple receptors of extracellular signals to intracellular signaling pathways. The G protein alpha subunit binds guanyl nucleotide and is a weak GTPase..
Pfam Number: pfam00503 Score: 764 E_value: 5e-82
Swissprot: Q9HFW7|GPA3_NEUCR

Sequence:
>SY0AAB1YL09FM1
ACTTGCATTGGCCGTCGTATCATTATGGAAGGACCCTTGCATTCCCAAAG
TTATGGCCCACCAAAACGAATTCTATCTTATGGATTCCGCACCTTACTTT
TTTGATGAGGCACCTAGGATCGGCCAAGCTCATTACATACCAACGGAATC
AGATGTTCTCCGAGCCCGAACAAAGACGACCGGTATATATGAGACTCGAT
TTTCAATGGGGCAGCTTAGCATTCACATGTTTGATGTTGGCGGCCAAAGA
AGTGAACGGAAAAAGTGGATTCATTGTTTCGAGACGGTAACTTCAATTAT
CTTCTGCGTCGCCCTCAGTGAATATGATCAAGTTTTATTAGAAGAGTCAA
ATCAAAACCGTATGATGGAGAGTCTTGTCCTTTTCGATTCGGTCGTCAAT
AGTCGCTGGTTTGTTCGAACAAGTATTATCTTGTTCCTCAACAAGGTCGA
TTTGTTTAAAACGAAGCTCGCTCGAAGTCCTCTATCGAATTATTTCCCGG
ACTATTCAGGCGGGAATGATGTTACAAGGGCCGCCAAGTACCTATTGTGG
CGGTTTAACCAAGTCAACAGGGCTCATCTAAACCTTTATCCACAGTATGA
TCTTCCGATCCGTTTAGGGAGATTTTTATACTAACACATGCATTAGTCTC
ACACAAGCAACAGACAC

Sequences in the Contig:

SY0AAB1YL09FM1