Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB1YK11FM1
Length(NT) : 534
Best Gene Model Blast : Link to GSTUMT00007606001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE64562.1| Score: 188 E_value: 5e-13
KEGG Definition: ankyrin
Accession: aor:AO090138000202 Score: 188 E_value: 3e-13
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB1YK11FM1
TTGGCACATCTGTTCCAAAATTCACACTCGATGATGGCGGAGGTTTGTTT
GACGTTCCTCAATTTCGGGTGTGTTCGGGAACTTGCGCCAACTCTTAGAA
GGGCCCCCTCAACAACCCCTTTACTAGAATATGCTTCGTATTACTGGGGG
GATCATACAAGGAAGGGGATGACGGAAAATGTGAAAACACTTGCCCTCAG
GCTTCTCGATGGGTTTGATAAGCATATATCTGCCCAACTAATTTTACTGC
ACTATAATCAATATCGAGGCCGGGGCCCTTATTTTAACGGTGCGGGAGGA
CCTACGGGATTTACAGGACTCCACGGCGTAGCATTTCTCGGGATCGGAGA
GCTTGTTACTTCTGTACTGGAGATGAAGGAATGGGACGCTAATGAAACCG
ATTGCATGGGGAGTACGGCTCTTATATGGGCAGCAATCAGAGGGCATCAA
GAGGTGGTAAGGGTGCTCTTAGATCGAGAGGATGTTAATCCCGACAAGGC
GGACATCGGGTGTGGCCGAGCCCCACTCTCCTGG

Sequences in the Contig:

SY0AAB1YK11FM1