Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB1YI15FM1
Length(NT) : 542
Best Gene Model Blast : Link to GSTUMT00010104001 E-value : 1e-170
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_09548
Accession: ref|XP_001551936.1| Score: 133 E_value: 1e-06
KEGG Definition: hypothetical protein
Accession: yli:YALI0C04565g Score: 132 E_value: 9e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB1YI15FM1
TTGGACCACTTCCACTTCCACTACCCGATAAATACTCGTCAGGCCGCTCA
TTGTTCATTACTCGACATGGCGCCCAAGAGTGATACTATGCAGAAGTTTA
ACGCATTTATGATTCGTTTGAATCGGTATAATACTTCCTCCATCCTCCAA
TCCGATCCAAACAGCATTCTTACTCTTCCTCCCGCCACTTGTCATTTCCG
ATAGCAAACAAATAAAAATAAAAAATGCTAATAATTTTACAGACTCCTCT
CTAGTCCCTCCGGTATTGACAAGGTTCTCATGACCACCCATTACACCCTT
GTCCTCCTTCCTCCATCCGTCCTCTCGTCTACTCGTTCCACCCGCATCAA
CATTCCAAAGCTCACCTCTCTAATATCCGATGTCCGCATGTTCATGCGTC
TTTGGGGTCTTATCGGCATCTACACCTGGGGCCTTTCCACCCTGTCTGCT
TCACGCCCCTCCCCCATTGAGATTGCCCAGGTTTTCGCCAACACTTGTTT
CCAGATCTGCGAGAACGTGGCGTACTTGTCTTCTCACGGAAT

Sequences in the Contig:

SY0AAB1YI15FM1