Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB1YI03FM1
Length(NT) : 586
Best Gene Model Blast : Link to GSTUMT00006643001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_06526
Accession: ref|XP_001796893.1| Score: 328 E_value: 4e-29
KEGG Definition: C6 transcription factor (UaY), putative
Accession: afm:AFUA_1G15470 Score: 310 E_value: 2e-27
KOG Definition: No Hit Found
PFAM Definition: Zn_clus, Fungal Zn(2)-Cys(6) binuclear cluster domain..
Pfam Number: pfam00172 Score: 134 E_value: 3e-09
Swissprot: P49413|UAY_EMENI

Sequence:
>SY0AAB1YI03FM1
CGAGTTCAGGAGTTCACAAGCGTAGGAGAAAGCACGCCAATGACGATGGG
TCGCATGCTCCGCCCGCTAGTTTGGATTCTCCGCCACCAGCGGTTGGGGT
AGTACCGGCACAAGTTGTGAAGCCGGTCACGGCGACGGCCGCGGTGGCGA
CTTCGGGATCTTCGTCTTTTCGGAACGTGTCCGCCTGCAATCGGTGTCGG
TTGAGAAAGAATCGGTGCGATCAGAGGTTGCCGGCTTGCTTGAGCTGCGA
GAAGGCCAATGTAAAGTGTGTGGGGTATGATCCGATTACTAAGAGGGAGA
TACCGAGGAGCTATGTCCATTACTTGGAGACCAGACTGGCCTATCTCGAG
TCGCTGTTGGCAAACAACAGTATCCCCTTTCCGCCTGCTGAATCTTTTCC
GGACCTGGCTCCGCCGCCCCCTCCCCCCTCTCAAACTCCCACGACGGCGT
CATTCCTGTCACCGCCCATAGCGACAGCAAATCCGGTTGCCCAGCTGGGC
CCATCCTCGCAGCAATTGCTGACCCCCATCGATCCGGCACTCACTGCGGG
TGGACCCATGCAGGAGCCTGACGTCAAACGCAAGCC

Sequences in the Contig:

SY0AAB1YI03FM1