Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB1YH07FM1
Length(NT) : 640
Best Gene Model Blast : Link to GSTUMT00006347001 E-value : 1e-150
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_01028
Accession: ref|XP_001220249.1| Score: 373 E_value: 3e-34
KEGG Definition: DNA repair protein Mus81, putative [EC:3.1.22.-]; K08991 crossover junction endonuclease MUS81
Accession: afm:AFUA_3G12750 Score: 355 E_value: 2e-32
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q5B8L2|MUS81_EMENI

Sequence:
>SY0AAB1YH07FM1
CAGGTTACTCCACTTCATTCCTTGCAGTCTGCTGTATCATACTTCTGCTG
GCTGCTATCTCCGACCGAGTCATCGTCGCCAATAATGGCCGACGATGAAT
GCGCCAATCCGCTCCTTCTTGGGTTTCTGAGGGACTGGTATGATACTGCA
AGGCAACAAAACTCCAAGAGAGTTACTACCTACAGAAATGCCTACGAAGC
TATGAGGGTATGTCCGATACCCTTTCAGCATCCTAGTGAAGCGATCCAAC
TCAAAGGCCTTGGGCCAGTTCTCTGCGAGAGGCTAACACAAGCTCTGCGA
ATCCATTGCGAGGCCAATGGTCTCCCGATGCCGAAAAAGGCAAAACGGCG
TTAGATTCCCACCCACCCATGTTTGACTATTTGTACTTGAGTATTAAGAA
CCTGACGGACGTCCTAAATAGGTCGCGCTCGTGATGACTTGGACGGAGGG
GAGAGCGCCGCTGGGGAAGGATCAGGAGCTGCCCCGCCACCGAAGAAAAG
ACGGCCAACCAAAGCCTACATTCCCAAGAAACGCACCGGCGCATATGCGC
TCCTATACGCTCTTTACAAGGGTGATGGAGATATGCTGACTAAAACGGAG
CTCATCGACCGAGCGAGACCGTACTGTGATTCGTCTTTCG

Sequences in the Contig:

SY0AAB1YH07FM1