Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB1YF22FM1
Length(NT) : 640
Best Gene Model Blast : Link to GSTUMT00012032001 E-value : 1e-170
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG09533.1
Accession: ref|XP_389709.1| Score: 150 E_value: 2e-08
KEGG Definition: hypothetical protein
Accession: fgr:FG09533.1 Score: 150 E_value: 1e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB1YF22FM1
TTGGAACTCCCGCAATCGCAGATCTCGGCACAAATCAATCAGCCAATCAC
GATCAAGAAAAGAAACAAGAAAAAAGAAAAAAGATCCGCGCTTCATCCTC
TATCCACTTTCTTTCTCTCTCTCCCCAACCCCTAGACTACAACCAACCCA
CCACCACCAATGGCCACAACGACGACAACGACAAAGACCCTTTATAGAAG
CCTCCTCCGCGAGCTACCGCCAATCTCACAGAAGCGCACACACCTGCACC
ACCGCCTTCGAGGATCCATCTCTGGTAAGGGGGAAGGGGATGGTGGAATG
TTATTGTTGGCACAGCTGACAACTTACCTCCGCGCACAGCGCACCTACTC
TGCGCTTCTGGAACGGTACAATCCCTCGTTGGGCGAGGGAAGTGGTGGCG
GCGACGATGATCGGGTCAGGATGAGTGCTAGGAGGGTGGGGCTTCACGTT
CCTGAGTGAGTGATGGATCGCGACGGTACTCGTACAACCACGGGGTTCTA
CGGACTGGTGGTGGCGATGGTTTGTTTGTTCTTGTTTTCGGGAGAGTTTT
TTTTTTTTGATCGTCGGTGGGTTGGTGGGAGGGGGTATTTTTTGATATCG
ATATCGTAAATCGAGTAGGTGTGTGTACTGTACTCGTACT

Sequences in the Contig:

SY0AAB1YF22FM1