Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB1YA02FM1
Length(NT) : 645
Best Gene Model Blast : Link to GSTUMT00000288001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: 70 kDa heat shock protein
Accession: gb|AAQ83701.2| Score: 778 E_value: 3e-81
KEGG Definition: hypothetical protein; K03283 heat shock 70kDa protein 1/8
Accession: spo:SPCC1739.13 Score: 752 E_value: 2e-78
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0100 Score: 772 E_value: 5e-83
PFAM Definition: HSP70, Hsp70 protein. Hsp70 chaperones help to fold many proteins. Hsp70 assisted folding involves repeated cycles of substrate binding and release. Hsp70 activity is ATP dependent. Hsp70 proteins are made up of two regions: the amino terminus is the ATPase domain and the carboxyl terminus is the substrate binding region..
Pfam Number: pfam00012 Score: 794 E_value: 1e-85
Swissprot: O93866|HSP70_TRIRU

Sequence:
>SY0AAB1YA02FM1
TTGGGCATATTTCAACGACTCACAACGCCAGGCCACCAAGGACTCTGGTC
TGATTCTGGTCTTAACGTCCTCCGCATCATCAACGAGCCTACTGCAGCTG
CCATCGCTTACGGTCTCCACTATGGAGCCCGTCGAGCGTGTCCTTCGTGA
CTCTAAGATCGATAAGAGTTCCGTCCACGAGATTGTCTTGGTTGGTGGTT
CTACCCGTATCCCCAAGGTCCAGAAGCTGGTGTCCGACTTTTTCAATGGG
AAGGAGCCCAATAAGTCCATCAATCCCGACGAAGCTGTCGCCTACGGTGC
TGCCGTCCAGGCGGCTATTCTTTCTGGTGATACCTCTTCTAAGACCCAGG
AGATCTTGTTGCTCGACGTTGCCCCACTTTCCCTCGGTATCGAGACCGCT
GGTGGTGTCATGACTCCTTTGATCAAGCGCAATACCACTGTCCCGACCAA
GAAGAGCGAGGTTTTCTCGACTTTCTCCGACAACCAGCCCGGCGTGTTGA
TCCAGGTATTCGAGGGTGAGCGCGCTCGCACTAAGGACAATAACTTGCTT
GGAAAATTCGAGCTTACTGGAATCCCCCCCGCTCCCCGTGGTGTGCCTCA
AATCGAGGTCACCTTCGACATTGATGCCAACGGTATCTTAAACGT

Sequences in the Contig:

SY0AAB1YA02FM1