Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB19YN22FM1
Length(NT) : 628
Best Gene Model Blast : Link to GSTUMT00005635001 E-value : 1e-120
Numbers of ESTs : 1

Blast Results:

Nr Definition: UPF0041 domain protein
Accession: ref|XP_001267246.1| Score: 483 E_value: 5e-47
KEGG Definition: UPF0041 domain protein
Accession: afm:AFUA_4G07750 Score: 482 E_value: 3e-47
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG1590 Score: 395 E_value: 2e-39
PFAM Definition: UPF0041, Uncharacterised protein family (UPF0041)..
Pfam Number: pfam03650 Score: 307 E_value: 4e-29
Swissprot: P53157|YGI0_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>SY0AAB19YN22FM1
TTGGCCGACACCCTGCCTTCCAGATAACCCCTCTGAACAACGACTTACTC
TGTCATGGCAGCAGCTATATCAGCCCTTAACGCGAAGATTCGCAGCAACC
CTGCGCTTAGCTACTTCTGCTCCACCCACTTTTGGGGTCCGGTCTCAAAC
TTTGGGATCCCGGTCGCTGCTGTCTTGGATATCACTCGTAAAGACCCTGA
GATTATCTCGGGAAAGATGACCACTGCTTTGGTCGTCTACTCAGCTGTCT
TTATGCGTTACTCCATGGCTGTCACGCCAAAGAATTACCTCCTCTTTGGT
TGCCATTTCGTCAACGAGTGTGCTCAATTGGCCCAGGGATATCGTTATAT
CAATTACTGGAACTACGGTGGTCGTGAGAGATCACTTGCGGAAAAGGCGA
AAGAGGCATCCACGCTCACTGCTGCTACCACAGTTCCTGGGCCTGCCAAG
AATTAACTGGTTATTCTTTCTCGGAGGAGTGGATGGAGTTAAACTTTAGA
TATCACTTGTCAAGTTATTCCGTGCTACTAGAGCTACAAAAAAAACAGGA
GCCGTATCTTTCCTTATTTTTCACCTAGAGAAGATTTTGTTGGGAATATG
ACGTAGGGCAGGAATTGCTACTATCAAT

Sequences in the Contig:

SY0AAB19YN22FM1