Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB19YL21FM1
Length(NT) : 610
Best Gene Model Blast : Link to GSTUMT00000706001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_06634
Accession: ref|XP_001222729.1| Score: 182 E_value: 4e-12
KEGG Definition: hypothetical protein
Accession: fgr:FG08936.1 Score: 169 E_value: 6e-11
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG3655 Score: 113 E_value: 1e-06
PFAM Definition: No Hit Found

Sequence:
>SY0AAB19YL21FM1
TTGGCGAACTCTCAAGGAGGGCATGTGGAAGTGTGACAGTGAAGGTGATG
AGAAGCATGCGTGGGAAGAATGCATCAAGCTGAGGGAGCGTATGTTTTGG
TGCAGAGTCGGGGGCGGGGTAATACCAGCCTTTATTCACAGGGAATCGGC
GAGAAATTCTGAGGATCACGGCGGAGCTGGGAGTTTGAGGCCTGCCGGTG
ACGAGACCCCACGTGATCTGCAATCTCCTAGGACACCAGAATTGAGAGGA
TGTGAAGGCCAGGTGAAACTGGAGGTTCCCAGGAGGAGAATAAGTAGGGA
ATTACCACCAATTGTCCCTGGGAAGGCTTCTGTTAGCGAAACTCCTTCGC
CGATAGCTCCTTCGCCGGTCGACAAGGAGCTTCCCCCACCTCCTAGAATC
TCCCTCGACAGCACCGCGAATGAAGAGGCAACTATTGAGAACCAAGAGCC
GTCCTGGGAGAACGGTCCTGCTGTTGGCATGACCTCGGAGCATTCACCCC
CCGCAGTCTCAAAGCAACCCATCGAGCCCGAATCGTTGGCTGCCCCGATC
GCAAAAACACCTGGACCGCCTGCGACCACTACTAAAAAGGAGCCCACTGC
GCCCGCTGGC

Sequences in the Contig:

SY0AAB19YL21FM1