Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB19YJ17FM1
Length(NT) : 634
Best Gene Model Blast : Link to GSTUMT00006786001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_02671
Accession: ref|XP_001793270.1| Score: 537 E_value: 3e-53
KEGG Definition: hypothetical protein
Accession: mgr:MGG_11246 Score: 526 E_value: 3e-52
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG1443 Score: 302 E_value: 2e-28
PFAM Definition: TPT, Triose-phosphate Transporter family. This family includes transporters with a specificity for triose phosphate..
Pfam Number: pfam03151 Score: 292 E_value: 2e-27
Swissprot: Q10354|YDB1_SCHPO
Gene Ontology:
GO:0005794 = Cellular component: Golgi apparatus

Sequence:
>SY0AAB19YJ17FM1
TTGGGGACTGCGATGGTCACTCACACAGATTCTGCTATTGAGAAACCCGG
CCACCTCTAACCCATTCTCATCTATATTTTTCCTAGCGCCGATCATGTTC
ATTTCAATCCTAGCAATTGCTATACCAGTGGAGGGGTTCGGACCGCTGAG
TGAGAGATTGGGCGAATTAGCAGCTCAAAAGGGTGCCGTCAACACTGCTG
CCATTCTGCTCTTCCCCGGTGCCATCGCTTTCCTGATGGTCAGCAGTGAA
TTTGCACTCCTCCAGCGCACCTCCGTAGTAACCCTCTCAATTTGCGGCAT
TTTCAAAGAAGTCGTTACGATCTCCGCAGCAGCGATAGTCTTCGGCGATC
CTCTAACCCCAATCAACATTTCAGGTCTCTGCGTCACAATATTAAGTATC
GCAGCATACAATTACATCAAGATCAAGAGGATGCGTCGAGAGGCACGAGA
AGAGACCGTCAGTGCAGCAGCATACGTCCCAGTCGGAGGCGACGACGAAG
AAGACGAAGATGAAGGGCTAGAAGAGCAGGCGAAAAGTGCAAGCATAGAC
GACGGTGTCCCCGGAAACACGGAAATACAGGTTGGCGAATCGGCGTTGAG
TCCTCGGTTTCCTGGGCCATCCACCTCACATTTG

Sequences in the Contig:

SY0AAB19YJ17FM1