Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB19YF13FM1
Length(NT) : 665
Best Gene Model Blast : Link to GSTUMT00004798001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 224 E_value: 2e-21
KEGG Definition: hypothetical protein
Accession: ang:An02g10560 Score: 194 E_value: 2e-17
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 159 E_value: 5e-12
PFAM Definition: No Hit Found
Swissprot: Q71S22|INVSA_XENLA

Sequence:
>SY0AAB19YF13FM1
TTGGCAAGAAGTGGGATGACGGAAAAGGTGAGAACGCTTGCACCGAGAGA
CTTCTGGATAGATTTGATGAGCATATATCCACCCAACTCATGTTATTGCA
CTATATTGAAGATGGAGACTCGGTCCGTTATTATTGCCAGAAGCAGGGAC
CCGCAGGATTTACAGGACTACACGCAGTAGCTTTTCTCAGGATTGCGGGG
ATAGTTTCGATTGTGTTAGAGATGAGGGAATGGGATGTTAATGCAACCGA
TATCCTGGGGAGAACTGCTCTCACATTGGCAGCTAGGAGTGGGCATGAGG
GAGTAGTCAAGATGCTTTTGGAGCGAAGGGATGTCAATCCCGAACACGCA
GACACCGCATATGGGCGCACACCACTCTCGTGGGTAGCTAGGCGCGGGCT
TGAGAGTATAGTTGAGATGCTTCCGAAACGGGGGGATGTCAATCCTGACC
AAAGAGACTATGGGTATGGCCGGACGCCACTCTTGTGGACAGCTGGGAGC
ATAAGGGAGTAGTCAAGATGCTTATAGAACGGAAAGATGTCTGCACCGCG
ACGCTAGATAGCAAGAACCAAACACCACTGTCAAGGGCTCTCTCTAATGA
ACACAATCGAGTCGTTGGGATGCTGCGTGAACCGGACAGTGTCAATTCTG
ACACCTCGTTTGCAT

Sequences in the Contig:

SY0AAB19YF13FM1