Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB19YC23FM1
Length(NT) : 613
Best Gene Model Blast : Link to GSTUMT00008408001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_06998
Accession: ref|XP_001554410.1| Score: 296 E_value: 2e-25
KEGG Definition: ankyrin repeat
Accession: aor:AO090113000090 Score: 252 E_value: 1e-20
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB19YC23FM1
TTGGTGAATATTGTCATAGCCGCCGCAAGACCTCTTACGCTTCAGGAGAT
GCATATCGCTTTCAGGATCAGGCGGGATCACACCACTATGAAGGACCTGG
GAGATTTTTCCCCTGCGTTCGCAAAGACAGTTAAAAATTTGTGTGGCCTT
TTCGTGCGGGTGATTGACGAAAAGATCTACCTTGTTCATCAGACTGCGAA
GGAGTTCCTAATTAAGGGATCATCGACTGGTCAGGGAAATTGGCAGTACA
CCCTGTGTTCCATGCATTCTAACTTTATAATGGCTGATATTTGTATTTCT
TATCTTTCGCTAGAGGATTCTGGGAACTACCCACTTCGGGGGGGTACTAG
CCGCTTGGTTTTCGAGCGGGGTGATATTGTTTATATCCGGGAGCTTGGCT
TCCTAGGTTACGCAGCTAACCATTGGCCTGACCACTTTCGAGATTCTCAG
GATCGGCAGCTGGAGCTATTCGAACTCACGCGCAGGATTTGCGAACGTGG
ATCTGAGAGATGTCTAACATGGTTTCAGGTGTTCTGGTCGAACGACCGGA
GGTACAGAGACCCTCACCATCGATTCCCCAATGATTTTACACATTTGATG
ATCGCATCATGGC

Sequences in the Contig:

SY0AAB19YC23FM1