Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB19YC20FM1
Length(NT) : 667
Best Gene Model Blast : Link to GSTUMT00008143001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein AN0472.2
Accession: ref|XP_658076.1| Score: 460 E_value: 3e-44
KEGG Definition: hypothetical protein
Accession: ani:AN0472.2 Score: 460 E_value: 1e-44
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG2254 Score: 510 E_value: 1e-52
PFAM Definition: Glyco_hydro_81, Glycosyl hydrolase family 81. Family of eukaryotic beta-1,3-glucanases..
Pfam Number: pfam03639 Score: 481 E_value: 2e-49
Swissprot: Q9UT45|ENG1_SCHPO
Gene Ontology:
GO:0043187 = Cellular component: cell septum surface
GO:0009986 = Cellular component: cell surface
GO:0042973 = Molecular function: glucan endo-1,3-beta-D-glucosidase activity
GO:0016998 = Biological process: cell wall catabolic process
GO:0009313 = Biological process: oligosaccharide catabolic process
GO:0030994 = Biological process: primary cell septum disassembly

Sequence:
>SY0AAB19YC20FM1
TTGGATGCTTTGCCGCATCATATTGCGAGTTTTGATGACAATACCTTAAG
GGGAAGAACCGGCCTCAAGCTGCAATCCCCAACGAAGGGTCTTATGGAGG
CTGTCCGCGGAAATAGTTGGACAATGGTTGAACGAAACCTACCCACGAGT
GTTGCTTGGCTAGCCACTCGCGGTCAGAGGTTGAACAGACACACAACGGA
ACTGATCGAACGAACATTAGTCAGTGAGATCAAGAGCAATATCATAGGCG
AAACGAATCTGAATAGCATGTATTTTAGCGGGAAGGCTTTCGCTAAATGG
TCACAATTCGCTTTATTAGCGCACGACGTTGTAAAAAAAGAAAATCTGAT
CCGGGAGGCGCTGGGGAAATTGATTACAGCCCTAGATCCCTATGTCAATA
ACCGTCAAAATCAGCCACTCGTATATGATGAAACTTGGAAGGGGCTCATT
ACCAGTGCAATTAAGCAGGGTCAGATGGCAGATTTCGGAAACGGCATGTA
TAACGATCACCACTTCCATTACGGATACTTTGTATATACCGCTGCGGTCA
TTGTGCGGCTGGAGCAGAGTCTAAACAAAGGAAAATCACCTTGGTTGGAA
CGTAACAGGGACTGGGTCGATATCCTCATACGGGACGTGGCTAACCCGAG
TACATTGGACCCCTATT

Sequences in the Contig:

SY0AAB19YC20FM1