Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB19YB09FM1
Length(NT) : 639
Best Gene Model Blast : Link to GSTUMT00004470001 E-value : 7e-34
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_00838
Accession: ref|XP_368406.2| Score: 116 E_value: 3e-08
KEGG Definition: hypothetical protein; K07443 methylated-DNA-protein-cysteine methyltransferase related protein
Accession: mgr:MGG_00838 Score: 116 E_value: 1e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB19YB09FM1
TTGGGAAGAATCTACTCGTACAAACAGACAAGGCCTGAAACTTTCTCCAT
ACGCACCCCGGTATCACGCGTTTCTGCATTCTCCTCTCTCTCTCTCTTCT
TTTCTACTCCGGGTTCTACCGTGCTCGGTTTCAGTCAGGCCTTGCTCAAC
CCACTGCATACCACACAGTGAGCTAGCTATCGGTATCTAACGGGACGTAC
TATATAGTATGCCGCACTCAGATGAGGCCACAGCCTTCTTTGTAGCTGTC
TATGAGGCCGTCCAGGTACTGATCTCCTTCCCCCCGCCTTTCAATCTATG
ATACAGTGTAATGCTCTAAAGGTCTAAACTGCACCTCTCGTTCGCAAAAA
ATACAGGAAATACCCTATGGAAAGGTCACTTCGTACGGCCACATCGCCCA
CTTAATAGGAAAGCCACAATGTCCAAGGTTAGTAGTACATACAATTATCA
TACGGTACCCTCCGAAACTCCCCAAACAGAACAAAGAAAAAACCTAGGGA
ATAGACGAACGAACAAGCCTCCCCAAACCCGGTGAAAGTATCATTCGTTC
ATTCATTCATGCTACAGACAAGTCGGTCAAGCCTTAAAACACCTCCCAGC
GGATCCAGCGAACACGTTTCACCATGGAAACGTCCCATG

Sequences in the Contig:

SY0AAB19YB09FM1