Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB18YO10FM1
Length(NT) : 660
Best Gene Model Blast : Link to GSTUMT00005451001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_500257.1| Score: 190 E_value: 5e-13
KEGG Definition: hypothetical protein
Accession: yli:YALI0A19778g Score: 190 E_value: 3e-13
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB18YO10FM1
TTGGCCACCCTCCTCATATCCACAATAGCCGTTTTCACAGACATCCTTCA
ACACAATCGGTCGCGACAGTGGCAGCTATCAATTATGCAAACAATAACTA
CATCCCCCAGCCACATATCTCGGAAGCAGCCATCGCAGCAACGCAGAAGG
TCATACCCCTAATGGCTGAAATGTTAGAAGGGCTTGCGACAGCTTTTGAT
AAGGAGCTGAATGACAAGGAGGAGGATCACAGCCAGGCTCAGCGATTATT
AGACAGTTCCACTCACGAGATACAAACATGTAAGGCTACGTCTGAAGAAA
CGCTGGCGCCTTTCGGTGATATCGCAACAATGGAAGCCCAGATTGAAGCT
CTCAAGGCAGAGGCAGATGCTCTGGCGGAGCAGTTGAAAGAGGTTTTCGA
ATGTGGGCAGTATCATGACCTTTCAGGCCTTGTTCGAGAGGAGGCAGAGC
AACTACCTCCTCAAGAGATGGAAGCCTTGGATGAGGATACCTCCGAAGCC
TGGTTGGAAAAGTCTGAGGTTGCTAGGGAACTTAGCCAACTTCAACAAGA
AAGGGCAGAGTTAAGGGATACAATTGTCAAAGCCTATGCAAGGAGCGGGG
CCGGTGAGAGGATGAGTGACTATAGGAGACTTATTGCGTTGAGCTGTTCG
CTGCTCCCCG

Sequences in the Contig:

SY0AAB18YO10FM1