Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB18YH12FM1
Length(NT) : 553
Best Gene Model Blast : Link to GSTUMT00000230001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An12g00850
Accession: ref|XP_001395174.1| Score: 173 E_value: 1e-15
KEGG Definition: hypothetical protein
Accession: ang:An12g00850 Score: 173 E_value: 5e-16
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB18YH12FM1
TTGGTTTCGATTCCTATTTCAAAAAAGGCACAACCTATTTCAACTTGAGC
ACCAGTTGATCCCATGGGTAATCTACTATCAAACAATCGCTCTGAGGGCC
TTACCTCACACCAAACTAGTGATGGTTCCCTCACCGTCGCCCATAGCCAT
ATTCACGGGGACCGTAGCGGTAACTATAACTCTGATAATGTCACCAATAA
TTATTACGACGCAAGGGGCGCGATCTCGTCTAGGGAGAAGGACGAAATCT
TGCAGTGCCTATACACCTCTCGATACGAGGAGCACCGACGCCGGGTTCGA
GCGCCGGTCGAGGGAATATGCACATGGGTTACGGAGCATCAAAAGTATAA
GGACTGGCTGGAGGGGGGGGGCATCTGAGCTCCTCTGGTTGTCTACGGAT
CCAGGTTGCGGGAAATCCGTCACTGCTTCATTCCTCGTGAGGCATCTGCA
GCGCCGGACGGACGCCATCGTTTGTTATTTCTTCTTTAAGGACGATAGCG
ACGAACAGAGGAGCGCGACATTTGCCCTTTGCGCCATACTACATCAGATC
TTT

Sequences in the Contig:

SY0AAB18YH12FM1