Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB18YD24FM1
Length(NT) : 625
Best Gene Model Blast : Link to GSTUMT00003328001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_01762
Accession: ref|XP_001247991.1| Score: 401 E_value: 2e-37
KEGG Definition: hypothetical protein
Accession: mgr:MGG_00889 Score: 307 E_value: 6e-27
KOG Definition: No Hit Found
PFAM Definition: DNA_methylase, C-5 cytosine-specific DNA methylase..
Pfam Number: pfam00145 Score: 121 E_value: 2e-07
Swissprot: Q94F88|CMT3_ARATH
Gene Ontology:
GO:0003886 = Molecular function: DNA (cytosine-5-)-methyltransferase activity

Sequence:
>SY0AAB18YD24FM1
TTGGTGCTGCTCTAGATAAGCATAACGCATAGAAACCCCCCAGGCGAGAG
CAACAGATCTGGCAACGCTGTTTCCGACGATTTTGAATGCCTGTGCATTA
TTCCCGAGGAGGACCTCATCATCCGGGAATGATTGCGCACGGCGGGCTTC
CATGACTGTTATGAGGCGATCCTCCATCGGGTGAACCCAGGTACCCGTAA
AGGCGCATTGGGGGGTCAACTGAGTAGTCACAGTACGGCAAAGGCCATCT
TCGTCAAGTCTGGACCAAGAGCGGCAATTAGGAACAAGCTTAGTTTTGTT
GGTAACTTTATCGCCAAAGAGCACTGGCATCACGCCTGTATCCAGCGCTT
TCCTCCAGGTTCTATTCTGCCCGAATTTTGGAACGTGGGAGATCAAGGTC
CTGGTTAGATTATTCTCTGTGCGGGAGTGGCGGTGGTCGGGGAATGGGAT
GCATGCACCGACGTGCCCAGTGCCGAGGTTTGGAAGGCCTCGCATCCCAT
TCTTAAAGGTAACAAGGCTGTATGGACAGGGTCCCTCGATTTCTCTCTGG
GCAAACTTGTCTCCATTGGGGGCGGTGAAGAGGCCTCTCTTTTTTACAAA
TGGTCCGTGGTCGTGACTGCGAGTT

Sequences in the Contig:

SY0AAB18YD24FM1