Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB18YD22FM1
Length(NT) : 612
Best Gene Model Blast : Link to GSTUMT00007808001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: probable t-RNA methyltransferase
Accession: emb|CAF06164.1| Score: 495 E_value: 2e-48
KEGG Definition: hypothetical protein
Accession: yli:YALI0B19558g Score: 477 E_value: 1e-46
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3115 Score: 559 E_value: 2e-58
PFAM Definition: Methyltransf_4, Putative methyltransferase. This is a family of putative methyltransferases. The aligned region contains the GXGXG S-AdoMet binding site suggesting a putative methyltransferase activity..
Pfam Number: pfam02390 Score: 269 E_value: 8e-25
Swissprot: Q12009|TRM8_YEAST
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding
GO:0030488 = Biological process: tRNA methylation

Sequence:
>SY0AAB18YD22FM1
GAGAGAAAAAAGCCAGAAAACCAGGACACAAAATGTCAACCCCGCCAACA
ACCTCAACCTCCACCTCCCCCCCAGCAAAGCGTCAGAAGCCATCCAACGG
CGAACGCACGGGCCACCGGTCTGCATATCGCTCGGATCTAACACGCCAGG
GCCTCCCGCAGAAGAAACACTACCGACAGCGCGCGCACGCAAACCCGTTC
TCGGACCACCAATTGGTGTACCCTCCATGCCCCGCTGACATGGACTGGAG
CAAGCACTTCTCCTCCCCCATCTCCACCTCCACCACCACCCCTGAAGAGA
AAAGGGTAGAAGTAGCGGACATCGGCTGCGGCTTCGGCGGCCTGATAATC
TCCCTCCCAAAGGTGCTCCCGGGCGTACGCATGCTGGGCATGGAGATAAG
GACGCAAGTGACGGAGTACGTCGACGAGCGGATCCGCGCGCTGCGACGCC
TAGCCGGCGGGGAAGCGTACGCGGACGTGGGCGTGATCAGGGCGAACGCG
ATGAAGTTTCTGCCCAATTTTTTCGAGAGGTCCCAGTTGCAGAAGGTGTT
CTTGTGCTTTCCCGATCCCCACTTCAAAGCTAGGAAGCACAAGGCTAGGA
TTGTATCGCCTA

Sequences in the Contig:

SY0AAB18YD22FM1