Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB18YC10FM1
Length(NT) : 667
Best Gene Model Blast : Link to GSTUMT00011477001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_04178
Accession: ref|XP_001244737.1| Score: 252 E_value: 3e-20
KEGG Definition: hypothetical protein
Accession: fgr:FG04390.1 Score: 229 E_value: 8e-18
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB18YC10FM1
TTGGGTCATCGCCAACGTCGGAGACGTGGTTTACTTTGATTTCCTCGAGA
GGAATCATACCGTCACCCAATCCACCTTCGACAACCCATGCGTTCTCAAC
CCCAACGGCGTCAGGTCCGGTTTCAGGCCCAACCCGCAGAACATTCCCGG
GAAGGAGACCTTCAACGTTACCGTCTCCGATGACAAGCCCAAGTGGTTCT
ATTGCGCGCAGGGAACGCACTGCAAGGCCGGTATGGTCTTCGCCATCAAC
CCGGGCGCAAAGTTCGAAGAATTCGTCAATAAGGCAAAGAGCGGCGGCAA
CGCTACCACTACTGCTGGAGGCCCCGCTGTCACTGGCACCCCTAACCCTT
CTGCCCCAGTTACACTTATTCCCTCAGGCACTATCACACCTCCCGTTAAC
TCGACCGCGCCTACGGGAACTCCCGTCTTCACAGGTGCTGGTTCAAGGGT
CACCTTCTCCATCACCACCTTTGTGGGAGTATTCCTTACTGCATGGTTGC
TCGTATAGTCGGTCAGATATTGTTGTTTTTGTTTTTGTTTTGCTTGCTTT
TTTTTTGGTTTTACCCTTTCATAGCGTCTAAAGATCTGGAGAAAAAGATT
TTGTAGTTTTAATTATGTATGATCACAACCCCCTTTTTTTGATACCTTGT
TTTGTCTTTATCCCCCT

Sequences in the Contig:

SY0AAB18YC10FM1