Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB17YO03FM1
Length(NT) : 704
Best Gene Model Blast : Link to GSTUMT00006257001 E-value : 1e-165
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001554752.1| Score: 841 E_value: 2e-88
KEGG Definition: ARP3_NEUCR Actin-like protein 3
Accession: fgr:FG10856.1 Score: 818 E_value: 4e-86
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG0678 Score: 659 E_value: 7e-70
PFAM Definition: Actin, Actin..
Pfam Number: pfam00022 Score: 402 E_value: 4e-40
Swissprot: P78712|ARP3_NEUCR

Sequence:
>SY0AAB17YO03FM1
TTGGCTTTCCTTACATCTTCATATACCCAGGATGGCTTCTCAAACCCCAG
CCGTTGTCATGGACAACGGCACGGGCTATTCCAAATTAGGGTTTGCCGGA
AACGATTCACCATCATTTGTGTTTCCTACGGCCATAGCTATCAAGGGATC
CTCCGGCGGAGGTGGTGGTTCAGGCTCCGGGCGTCCGGCAATAGCTCAGA
AACCCTCTTACCTGACCGGAGGGGCTGGTCCATCTGGCCACTTGAGTGCC
AAAAGGGGCACTGAGGACCTGGATTACTTTATTGGGGATGAAGCATTGGC
ACAAGCGAGTGGTCCAGGTACGGGTCGCTGTTCTTTCGGCAGTAGTTGCG
GGCCGTGTTCTAGGGCCAAAATTCTGGGTTTCGGGAGGGGAAATGGTTGA
CGACTGGTAATAGGCTATGGCATTCATTATCCGATAAGGCATGGCCAAGT
TGACAATTGGGACCATATGGAGCGCTTTTGGCAGAATTCGATTTTCAAAT
ATCTTCGAGTTGAGCCGGAAGACCACTATTTCCTTCTAACCGAACCTCCT
CTAAATCCTCCAGAATCCCGTGAAAACACCGCCGAGATCATGTTCGAGAC
CTTCAATTGCGCCGGATTATATATTGCCGTGCAAGCGGTACTGGCATTGG
CTGCAAGTTGGACAAGTAGCAAGGTTCAGGACCGGAGCTTGACTGGTACT
GTTG

Sequences in the Contig:

SY0AAB17YO03FM1