Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB17YK20FM1
Length(NT) : 650
Best Gene Model Blast : Link to GSTUMT00006676001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: calcium sensor NCS-1
Accession: ref|XP_363624.1| Score: 475 E_value: 4e-46
KEGG Definition: calcium sensor NCS-1
Accession: mgr:MGG_01550 Score: 475 E_value: 2e-46
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0044 Score: 386 E_value: 3e-38
PFAM Definition: No Hit Found
Swissprot: Q09711|NCS1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0005886 = Cellular component: plasma membrane
GO:0005509 = Molecular function: calcium ion binding
GO:0019933 = Biological process: cAMP-mediated signaling
GO:0006874 = Biological process: cellular calcium ion homeostasis
GO:0031137 = Biological process: regulation of conjugation with cellular fusion

Sequence:
>SY0AAB17YK20FM1
TTGGCATAATCTATCCATATTAGCTCAAACTCACTTGCACCACTACTACC
TACCTGCTACCGTTCCATACCACCACCGCCAACCCCCCGGTTCCCACCCT
CTACTCTACCTAACCCTCCACTATTACCAGACCTCCATCTTCCCCAGACT
TCATAATATTATCACACAAACAGCTTTGTCTCTTGAGCCTTTCTCTACTG
AACAGTGGTATACTGCCCCAGGCGCTAATACCTCGCTGATTAGATTACCA
ATCGACAACAGCTTCAGTCAGCTGTTAGAACCATCCCCCCTTGCGATAGA
CACCCTCTAGTAACGGTATTTCGTGATGGGTAAAACTCAGTCTAAGCTCA
CTCAGGATCAGTTGCAGGAGTTGCAGAAGGCTACGCTTTTCGAACGCAAG
GAACTTCAGCAATGGTACAAAGGTTTCCTCAAGGACTGTCCTTCTGGGTC
TCTTGGAAAGGTCGAATTTCAGAAAATATACAAGCAGTTTTTTCCGTTTG
GCGACCCCACCACTTTCGCAGACTATGTCTTCAAGGTGTTCGACGCGGAT
AATTCCGGTCAAATTGATTTCAAGGAGTTTATCGTCGCTTTGAGCGTCAC
CTCACGCGGATCCTTAGAGGACAAGCTCAATTGGGCGTTTCAACTCTACG

Sequences in the Contig:

SY0AAB17YK20FM1