Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB17YK11FM1
Length(NT) : 628
Best Gene Model Blast : Link to GSTUMT00002482001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_02465
Accession: ref|XP_365763.1| Score: 509 E_value: 5e-50
KEGG Definition: hypothetical protein [EC:3.1.1.45]; K01061 carboxymethylenebutenolidase
Accession: mgr:MGG_02465 Score: 509 E_value: 2e-50
KOG Definition:
Classification: [Lipid transport and metabolism, Signal transduction mechanisms].
Kog Number: KOG1435 Score: 249 E_value: 2e-22
PFAM Definition: ERG4_ERG24, Ergosterol biosynthesis ERG4/ERG24 family..
Pfam Number: pfam01222 Score: 334 E_value: 3e-32
Swissprot: P36209|STS1_SCHPO
Gene Ontology:
GO:0043157 = Biological process: response to cation stress
GO:0042493 = Biological process: response to drug

Sequence:
>SY0AAB17YK11FM1
TTGGGGAGGAAGCCCTACGGGGAGAATGGCTCAACCAGTGGACCCACTAT
TCCCAAGGGAGATGTAGGGAGCGATACCACCACGAAGGACAATCTCAGAA
TGGGCGATGATCACAGGGTCGACAACAGCTCTGAATTCGAGTTTGGAGGC
GTCTGGGGTACTGGGCTTGCTATGGTCTTCTTCCCGCTGCTCATGTGGTA
CATGTGGGTTGGCCAGGTCTACTACAATTCTCAATTCCCGATGCCAGGGA
AGGAAGAGGCAATTGGCAATTTTGTACGCAAGGTCGCTAAATTGGCTTAT
GAGTGCTCATACCCTACCAAGAAGGCTTGGTTGGTCTATTGGGGCTTCTT
GGCCTACCAGAGTTTGCTATACCTCACACTGCCCGGTGTCTGGGCCAAGG
GAAACCCAATTCCTCACAGGAACAACGTTCGTCTCGATTACTACTGCAAT
GCTATATGGGCTTTCTATTTCACTACCGCCACTGCCATTGTTTTCCATGT
GGCTCAAATCCTCCCAATCACCTTCTTGGTGGACGAGTTTGGCTCCTTTA
TGAGCGTTGGCATTCTCTCTGGGATCCTTGTCAGCTTCATCGGGTATTTC
AGCGCAATATATCGGGGTGCTCAACATA

Sequences in the Contig:

SY0AAB17YK11FM1