Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB17YJ03FM1
Length(NT) : 616
Best Gene Model Blast : Link to GSTUMT00005934001 E-value : 2e-61
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001213551.1| Score: 230 E_value: 1e-28
KEGG Definition: predicted protein
Accession: aor:AO090005000176 Score: 159 E_value: 9e-10
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB17YJ03FM1
TTGGGACGCATCCCCATCACTTGCACAGCCATGTTCAATATTATCTATGC
GGTACTCTAAAGAGAAAAGAAAAAAGAAACAAAAGCAGGAGAGAAAAAAG
GGATACAAGACACAACACAGCCGGTCCAGCAGTCATCCAATTAACTCTAT
CCTTCGACCCACAGCTAAAATTTGGACAGCTAGCCGAGTGAGATCCTATG
AACTTGCCAAGCCTTAAGTTTACGAAAATCTGACAACCCATGGACACGGC
TTCTCCCCATACGTGGCGATATTCGACTCGAGAACTTTATTAATGTCATC
ATTGGGCGCGTTCCACATCCTCGTTCCGGAGTCCCTACCCCCCCAAATAT
TAGCCTTCAACCTCTATGAAACTTCCCCCTCCAGGAAGAGGAAGAAAAAA
AAACTCACATCATAATCCCAACATGGTGGATACTGTTCCTCTTCCCAGAC
GCGCAGCTGCACTCATTGCCGAAGAAAACGGCGTCACCGACCCTCCTCTC
CGCATAACCCACCTTGCGCATCCCGTTCGCGGCGAGCGTTGCGTCGCTGG
CACAGTACATACTATGCGTGACTCTGAGGCCGGCTTTGAAGAGGTCGCGA
CCAGTGACTTGACACA

Sequences in the Contig:

SY0AAB17YJ03FM1