Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB17YI24FM1
Length(NT) : 502
Best Gene Model Blast : Link to GSTUMT00005162001 E-value : 1e-175
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0921 Score: 125 E_value: 3e-08
PFAM Definition: eIF-4B, Plant specific eukaryotic initiation factor 4B. This family consists of several plant specific eukaryotic initiation factor 4B proteins..
Pfam Number: pfam06273 Score: 117 E_value: 3e-07

Sequence:
>SY0AAB17YI24FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGGAAAAAGAGGAAAAAAAA
AAAACCGATCCCAAGATTACGGGCGAGCACGCAATAGCGACTAAGAAGAG
GAGAAAAGAGAAAAAAAAAAAAAAAAAAAAAAAAAAAGGGTGACAAAAAG
AGCGTGGAGAAGAGGAAGCAAAGATTGAGGAACAATATGAAGTGTTATCG
GCGATAGATATTGTTGACAGGTTCCTCCCGGTGACGGTCCCGACTGGAAC
TTCGTCGTTGGATGCCACCTCCACCTCCACCACCTGGGCCTCCACCCCCG
CCTCCATTGTAACCCCGATCATGTCCTCTATCCCTGCGATCACCTCTATC
GCCTCTGTCACCACGGTCCCTATCACCTCTATCCCGGTCGCTCCGATCCC
AGTCCCTACTCCTATTATTACCGCGACGGTCATCTGGCCCCCCACCTCCG
TAAGATGGTATATAGGTATCAACATTGCCGCCTCCGTTACCCCGATTGGT
CC

Sequences in the Contig:

SY0AAB17YI24FM1