Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB17YI18FM1
Length(NT) : 617
Best Gene Model Blast : Link to GSTUMT00005541001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001541540.1| Score: 480 E_value: 1e-46
KEGG Definition: hypothetical protein
Accession: ang:An02g14710 Score: 450 E_value: 2e-43
KOG Definition: No Hit Found
PFAM Definition: TRP, Transient receptor potential (TRP) ion channel. This family of proteins are transient receptor potential (TRP) ion channels. They are essential for cellular viability and are involved in cell growth and cell wall synthesis. The genes for these proteins are homologous to polycystic kidney disease related ion channel genes..
Pfam Number: pfam06011 Score: 337 E_value: 1e-32

Sequence:
>SY0AAB17YI18FM1
TTGGGTAGCGAATCTGGCAATACGACTGCCAGTAATAAGACTCGCCGTGC
GCTGGATTGGACTGTGGCACAGGTCTTTGAGCGTGCGGTTGAGGTGAATG
GGACAACGATTGCAGGCAACGGCACCAATTCTACCTCCACTGATGATGCC
CAGGCCAAGGTTATGCACTATGTAGAGGGTGTCCAGGCATATGTTGAAAA
ATTGCAAATTCCCTCGGCCAATACTTTTATGACTGTCCTGTTGGTCTTCG
CCATCGTCATTGCCTCTATCGCTGTCTGCATCCTGTTATTCAAGGTTATC
CTGGAAACTTGGTCGTTGTTCGCTAGCTTCCCAAAGTCCTTGACCGGATT
CCGCAAGAGGTACTGGGGTTTCTTGGCAACAACCATTGTTAGACTGGTGT
TGGTGCTTTATGGAACCTGGACTCTGTATTGTCTCTATCAGTTTAGGAAT
GGTGACTCCTGGGGTGCTCATGTTCTTGCTGGTGTTACCCTCGCCGTTTT
CACGGGTGTCTTGGGCTTCTTCGCTTTCCGCATCTTTATTCTTGCTCGCC
GCCAGAAGGCCATTGATGATGAGAATGAGGCTGCCGCATTGAAAGGCGAC
GATGAGCACAAGCCCCA

Sequences in the Contig:

SY0AAB17YI18FM1