Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB17YI15FM1
Length(NT) : 677
Best Gene Model Blast : Link to GSTUMT00009792001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: DNA replication factor C subunit Rfc1
Accession: ref|XP_755554.2| Score: 264 E_value: 1e-21
KEGG Definition: DNA replication factor C subunit Rfc1, putative
Accession: afm:AFUA_2G12220 Score: 264 E_value: 7e-22
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG1968 Score: 177 E_value: 5e-14
PFAM Definition: RFC1, Replication factor RFC1 C terminal domain. This is the C terminal domain of replication factor C, RFC1. RFC complexes hydrolyse ATP and load sliding clamps such as PCNA (proliferating cell nuclear antigen) onto double-stranded DNA. RFC1 is essential for RFC function in vivo..
Pfam Number: pfam08519 Score: 196 E_value: 3e-16
Swissprot: P38630|RFC1_YEAST
Gene Ontology:
GO:0005663 = Cellular component: DNA replication factor C complex
GO:0005515 = Molecular function: protein binding
GO:0006272 = Biological process: leading strand elongation
GO:0006298 = Biological process: mismatch repair
GO:0000278 = Biological process: mitotic cell cycle

Sequence:
>SY0AAB17YI15FM1
TTGGAGCATGCTTGCCAAACGGCTTGAGCGCGAAGGCAAAGATGCAATCC
CGGAGGTTATCGATACTATGGATGACTACTTCCTGACAAAGGATGACTGG
GATGCAATTGTTGAGCTCATTGTTGGACCGGCGAGCGCGCTTGACATCCC
AACTCTAACTAAGAGCTCATTTACCAGACAATACAATTCAATGTCTCACC
GCATGCCTTTCATGAAGTCTTCCAGCGTCGCGGCTCCAAAGGCCGGTAAG
CAAGACGCCCCAGATCTTGAGGACGTCATCGTGGAGAGCGAGGATGAAGG
CGGCGATGAGGACATCATTAAGAAACAAGTTGAAGAGGAGCAAGACCTCT
CGAAGGACAAGTACGTTAAGGCTAAGAAACCTAAGGCCACCCCGAAGGGT
AAGGGTAAAGGAAAAGCTGCGTCAAAGAAAAGCCAGAACGAAGGCGAAGA
TGAAGATGAAGATGATGAGCCTAAGAGGAAACCGAAGTCTGCATCAAAGC
CGAGAGCGAAGGCTAAGGGGAAAAAGTGACGGCATGTTTGCAATAATCAA
CCCTTGGAGTTTTCCTTTCTTTCTCGATTTTCAATGTGTATATTTAGTTT
TACGTTTTTTAGCTACATGATTACCCATCTCAGCATTTTAAAGTTATCAG
TGTGTTGCTGCTTATTGTGATTGCTTT

Sequences in the Contig:

SY0AAB17YI15FM1