Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB17YD18FM1
Length(NT) : 581
Best Gene Model Blast : Link to GSTUMT00007948001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_03862
Accession: ref|XP_001223076.1| Score: 390 E_value: 2e-36
KEGG Definition: hypothetical protein
Accession: fgr:FG09564.1 Score: 369 E_value: 3e-34
KOG Definition:
Classification: [Chromatin structure and dynamics, Transcription].
Kog Number: KOG2626 Score: 183 E_value: 8e-15
PFAM Definition: No Hit Found
Swissprot: O60070|ASH2_SCHPO
Gene Ontology:
GO:0000785 = Cellular component: chromatin
GO:0048188 = Cellular component: COMPASS complex
GO:0048189 = Cellular component: Lid2 complex
GO:0006338 = Biological process: chromatin remodeling
GO:0051568 = Biological process: histone H3-K4 methylation

Sequence:
>SY0AAB17YD18FM1
TTGGAGCCTGTACGCCACCAAAAACACTTCCGAATTCACTCATCAAAGTC
TACAAGAACGGCAAGTACGTCGGAACACCCTGGGAGGACCTCTTTGCCTT
CTTACCCCCCGCCTCGAGACCTTTAGCTACCGCAGGCGGACGAGAACTCG
ACGACGGGACGTTAGGTTATTACCCCGCTGTTAGTGTATTTAGAGGTGCG
ATTGTTGAGACAAACTTTGGTCCGGACTGGCTGGCTCCACCAGACGTGGA
AGATATTTCTGGGATGAGACCTTTATGCGAGCGTTATAACGAGCAGATTG
CTGAGGACATTACTTATGACATCGTGGATGAGGTTGGTCTACTCTTCACT
AAAGTGCCTGGAGTGGACGATGCCACAGCTGCGCCGGGGGTGGCGGCGGA
AGGTGGAGAAAATGGAGGATTAGTGAAAGAGGAAATCAAGGAGATGGTTA
TGGAGGATGAGTAATGAGTAGGGTGTGCAACATTGTATGTACTATAGGCG
TATCAGGCTTCTATATTTCTGTCTCTCCGAGATAACTTTTTCTCCTTTGC
TTCCTGCGGACATCTAACTGGATAAAATACC

Sequences in the Contig:

SY0AAB17YD18FM1