Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB17YD17FM1
Length(NT) : 574
Best Gene Model Blast : Link to GSTUMT00008240001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_15875
Accession: ref|XP_001806012.1| Score: 226 E_value: 3e-17
KEGG Definition: hypothetical protein
Accession: ncr:NCU03243.1 Score: 226 E_value: 1e-17
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P40015|ISC1_YEAST
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum
GO:0031307 = Cellular component: integral to mitochondrial outer membrane
GO:0004629 = Molecular function: phospholipase C activity
GO:0046513 = Biological process: ceramide biosynthetic process
GO:0009651 = Biological process: response to salt stress
GO:0030149 = Biological process: sphingolipid catabolic process

Sequence:
>SY0AAB17YD17FM1
TTGGGCTCAAGTTACCAATAAAGTGGGGGAGAGAGAAAACGAGCAATACC
TGCCGCCCACCATAATAGACGAAATTCTGGAACTTGTTGCGAAATACACA
AAAAGGGAGAATTTTGAATATCATTGGAGGCTATACCATTTTTGGGGATC
TCTGGTGGCTCTTGTAGGGCTCCACGTGGGAGTTTGGTGGAGTCCACACA
ATGGGGTTTCTTTTGCCTTAATGTTTGTTGCGTGTGCAGTCGCAGTCACT
GGTGGTTTAGATGGATTGATTGGATTCTTGTTTATGGGTAGCGAGCTAAG
AGCACTAAAGGAATTCGAGGAGGAGTTGAAAATGTACCGACATCTTGCTG
CTAAGGCCCACGGAGCTAGTAGCTCTAGGTCACACGTGTCAGGGTCAAAA
GTAGCATTAGTTACTAACGGGGCTACCGAGGGTACGTTCCGTTCTTCGAA
TAGCGCCGATGAGGTGAGGATTGACATTCATGAATCTGTATAGTGGATGT
TTGACTAGTTCGTGTTTGAGTTATTTGGTGCCCTATTCACCTGTTGCTAA
CTAGGATATAGGGCACTAAAGGAA

Sequences in the Contig:

SY0AAB17YD17FM1