Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB16YP01FM1
Length(NT) : 510
Best Gene Model Blast : Link to GSTUMT00012001001 E-value : 3e-88
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_07991
Accession: ref|XP_001240828.1| Score: 204 E_value: 6e-15
KEGG Definition: hypothetical protein
Accession: ani:AN5151.2 Score: 200 E_value: 1e-14
KOG Definition:
Classification: [General function prediction only, Signal transduction mechanisms].
Kog Number: KOG0748 Score: 155 E_value: 1e-11
PFAM Definition: HlyIII, Haemolysin-III related. Members of this family are integral membrane proteins. This family includes a protein with hemolytic activity from Bacillus cereus. It is not clear if all the members of this family are hemolysins. It has been proposed that YOL002c encodes a Saccharomyces cerevisiae protein that plays a key role in metabolic pathways that regulate lipid and phosphate metabolism..
Pfam Number: pfam03006 Score: 106 E_value: 5e-06
Swissprot: Q09910|YAJB_SCHPO
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane
GO:0005794 = Cellular component: Golgi apparatus

Sequence:
>SY0AAB16YP01FM1
TTGGAATATATGCCATGCAGGTACCCGAGAGGTTTTACCCGGGATGTTTT
GATTGGATCGGTGGCAGCCACAACATTTGGCATGTATGTGTGCTCGGGGG
GATTTTATTCCATTGGCACGCTATGCATGATCTTTTTCACAGAGCTTTTG
AAATGGCCACTGCTTAGAACCTATCTTCCACGATTACCATTTCAACCTTT
CATTTTATTTCTTGCTTCTCGACTAAGCACCATCGATGTGAATTTCTCCC
TTACGGATGGATACTCCTTTTCCCTTGCTCCCTTGGCACCTCCATTTTGG
AGTGAGTGAGAAGTGGTTGAATGATTGATTGATTTCTACTAGAATGAGAC
AGGACAAGAGGTAATTTCGTTATATCGGCCTACTCTTATTCATTGACATA
CCTGGACTATAGAGTAATACACAAATGTGATTTGTTTGTTTCTAAGTAGA
GATTGAGGTGGATGCGAGTAGTACGAGTACTGTTACTTTTGTTTTTTCGT
TGTTTACTCT

Sequences in the Contig:

SY0AAB16YP01FM1