Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB16YO01FM1
Length(NT) : 646
Best Gene Model Blast : Link to GSTUMT00010607001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001226669.1| Score: 467 E_value: 1e-70
KEGG Definition: hypothetical protein
Accession: mgr:MGG_12003 Score: 469 E_value: 4e-70
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG1575 Score: 368 E_value: 4e-36
PFAM Definition: Aldo_ket_red, Aldo/keto reductase family. This family includes a number of K+ ion channel beta chain regulatory domains - these are reported to have oxidoreductase activity..
Pfam Number: pfam00248 Score: 263 E_value: 4e-24
Swissprot: Q9P7U2|YI7E_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAB16YO01FM1
TTGGGGTGTGTGGACGAAGGGGCGTCATTGCAGGTGCTGAAGGCTGCCTA
CGATCTCGGAATCAATACCTGGGACACGGCAAACACCTATTCCAACGGAG
AGTCCGAAAGAATTATCGGGAAGGCTATTAGGAAGTTTAAAATTCCAAGG
GACAAGCTAGTCATTATGACAAAGTGTTATTGCGCCGCTGGGGATGAGCC
GGGAATGCAGAGCTATATGATGCCCGAGTTGAAGTTTCGGAAAGATTATG
TTAATCGGCTTGGTGAGCTTTGGCGGGCTTTCACGGAAGGCTATATTCTC
AGAGGTCAATTCTTCCCTGGAGAGGCTGGGGTTGGAATATATCGATTTGC
TCCAGATTCATCGGTGTGATCCTGAGACGCCGCCGGAGGAGACTATGGAA
GCGTTACATGACCTTGTCAAGAGTGGGAAAGTCCGATACATCGGTGCCTC
ATCTATGTGGACGTGGCAATTTTGCCTCTACCAGCAAACCGCAGAACGCA
ACAACTGGACAAAATTCATCTCAATGCAGAACCAATATTCCCTCGTATAC
CGAGAGGAAGAGCGTGATATGATACCTTACTGCCGCGCAACCGGCGTCGG
AATAATCCCCTGGGCGCCTCTAGCGCGCGGGCACCTAACCCGCCTC

Sequences in the Contig:

SY0AAB16YO01FM1