Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB16YJ17FM1
Length(NT) : 664
Best Gene Model Blast : Link to GSTUMT00002776001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: gb|EDR12551.1| Score: 221 E_value: 1e-16
KEGG Definition: hypothetical protein
Accession: fgr:FG03461.1 Score: 189 E_value: 3e-13
KOG Definition:
Classification: [Defense mechanisms].
Kog Number: KOG1515 Score: 135 E_value: 4e-09
PFAM Definition: Abhydrolase_3, alpha/beta hydrolase fold. This catalytic domain is found in a very wide range of enzymes..
Pfam Number: pfam07859 Score: 173 E_value: 1e-13
Swissprot: P24484|LIP2_MORS1
Gene Ontology:
GO:0004806 = Molecular function: triacylglycerol lipase activity

Sequence:
>SY0AAB16YJ17FM1
TTGGCTTTTCTTTAGTAACTTACCTCACTAAAACGCATTCTTCTTAGCCA
TGCAAAACGCAATCACTGAGCCCTACAAATATCATTCTAGTGGTCGACCT
CTAAACGTCGATATCGCCCTCCCACCAAAACATTCTCCGAGTAAGAAATA
CCAAACACTCATATGCTATCACGGGGGCGGTCTTGTCTGCGGTAGTCGGC
ACACATATATCCCCCTCTACCTGGCAAGCAAGCTTCGCAAGCTGGGTTGG
ATCATTATTTTTCCGGACTATCAACTCCTGCCTGAAGCTACTGGTTGGGA
CATCCGACAAGACGTGATTGACCTTGAACAATGGATTTTGAAGGAGCAGG
CCACATGGGGAATTGACGTTGATAAGATTGCCCTGAGTGGGACGAGCGCT
GGTGGGTACCTCGGTGCCCTTACCGCTGTTACATGGAAAACCATCAAACC
ACAAGCTTTCACTAGTGTTTACGGAATGGTGGATATTACCAGCGACTGGT
ATAGCGCAAAGAAACAACCAGGGCTCACTGTCATGGGAGTTCCAGTCGAC
ACGATCAAAGAGGAAAATTATCAGAAACTCTACGAAAACGACCGGGAAGT
TGTCTGGGATGACCGCGTGACCAAAGACGATAGATCGCTGATATTCTTGT
TGTTTATCCGAGAA

Sequences in the Contig:

SY0AAB16YJ17FM1