Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB16YI01FM1
Length(NT) : 628
Best Gene Model Blast : Link to GSTUMT00008058001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG03703.1
Accession: ref|XP_383879.1| Score: 600 E_value: 1e-60
KEGG Definition: hypothetical protein
Accession: fgr:FG03703.1 Score: 600 E_value: 7e-61
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG0471 Score: 220 E_value: 5e-19
PFAM Definition: Alpha-amylase, Alpha amylase, catalytic domain. Alpha amylase is classified as family 13 of the glycosyl hydrolases. The structure is an 8 stranded alpha/beta barrel containing the active site, interrupted by a ~70 a.a. calcium-binding domain protruding between beta strand 3 and alpha helix 3, and a carboxyl-terminal Greek key beta-barrel domain..
Pfam Number: pfam00128 Score: 125 E_value: 5e-08
Swissprot: Q9P6J3|MALT_SCHPO
Gene Ontology:
GO:0009986 = Cellular component: cell surface
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0004558 = Molecular function: alpha-glucosidase activity
GO:0044247 = Biological process: cellular polysaccharide catabolic process
GO:0000025 = Biological process: maltose catabolic process

Sequence:
>SY0AAB16YI01FM1
TTGGGTGGACAAGTGGCAAACGTTCATGATAAACAACGATGGTTGGAACG
CAGTCTATGATGAGAACCACGACCAACCTCGCTCAGTCTTTCGCTACGTC
GATAGAAGTGTTGTTGAAAGGAGCTTTCAGGCCAGGGAAATGGCGGCCAA
AATGTTGGCGACTTTCCTAGTCTTGCAGAGCGGTACTTTGTTCCTTTACC
AAGGACAGGAAATAGGAATGGGCAATGTGCCGAGGGAATGGGGTATCGAG
GAATACAAGGACGTTGAAGGTTTGAACTTCTGGAATAAATTATTGGAGGA
GAGAGAGGGCGACTTGAGCAAGATGAAGGATGCCATGGAGGCTCTTCAGT
CGAAGGCCAGAGATAATGCTCGAACTCCGGTTCAGTGGGATTCCAGCCCT
CAAGCAGGATTCACCACCGGTAGTCCTTGGATGAGGGTGAATGATGACTA
CGAGGAATGGAATGTCGCAGCACAAATTGACTCTCCGTCCAGTGTGTACA
ATTACTACACGAAGCTGCTCGGCCTCCGTCGGGATCACAAGAACATTATC
GTCTATGGGGGTTTCGAAATGCTTTCTCATAGTCATGAGAAGGTCTTCGC
GTATAAGCGCTACGGCTATCACGGTCCA

Sequences in the Contig:

SY0AAB16YI01FM1